Review



anti human adam10 ecd mouse mab igg2b  (R&D Systems)


Bioz Verified Symbol R&D Systems is a verified supplier
Bioz Manufacturer Symbol R&D Systems manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    R&D Systems anti human adam10 ecd mouse mab igg2b
    Biochemical evidence for <t>ADAM10-mediated</t> CA IX ECD cleavage. (A) Verification of the cleavage activity of rhADAM10 catalytic domain towards the fluorogenic peptide Mca-K-P-L-G-L-Dpa-A-R-NH 2 . The peptide was used at the final concentration of 10 µM in a total of 100 µl reaction mixture with 10 ng of the rhADAM10. The cleavage was allowed to proceed for 30, 40, 50 and 120 min. Time-related increase of the fluorescence emitted from the peptide proves that rhADAM10 was active in comparison to negative control without rhADAM10. (B) ELISA analysis of CA IX ECD in culture medium obtained from CHOwt-FL-CA IX and CHOwt-NS-CA IX cells transiently expressing FL-CA IX and NS-CA IX, respectively. Transfected cells were treated with rhADAM10 (500 ng/ml) for 24 h (Data were analyzed by Student's t-test). (C) Incubation of CHOwt-FL-CA IX cells with ADAM17 activator PMA (20 µM, 3 h), ADAM10 activator IONO (1 µg/ml, 3 h) or rhADAM10 (500 ng/ml, 24 h). Data were analyzed using one-way ANOVA followed by Dunnett's test. Experiments were performed in triplicates and repeated twice. The results were expressed as the mean ± SD. **P<0.01 and ***P<0.001. ADAM, a disintegrin and metalloproteinase; CA IX, carbonic anhydrase IX; rhADAM10, recombinant human ADAM10; ECD, ectodomain; FL, full-length; NS, non-shed; IONO, ionomycin; PMA, phorbol 12-myristate 13-acetate; ns, non-significant.
    Anti Human Adam10 Ecd Mouse Mab Igg2b, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 37 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+anti+human+adam10/Human+ADAM10+Ectodomain+Antibody/pmc09813547-36-12-20
    Average 94 stars, based on 37 article reviews
    anti human adam10 ecd mouse mab igg2b - by Bioz Stars, 2026-09
    94/100 stars

    Images

    1) Product Images from "ADAM10 mediates shedding of carbonic anhydrase IX ectodomain non-redundantly to ADAM17"

    Article Title: ADAM10 mediates shedding of carbonic anhydrase IX ectodomain non-redundantly to ADAM17

    Journal: Oncology Reports

    doi: 10.3892/or.2022.8464

    Biochemical evidence for ADAM10-mediated CA IX ECD cleavage. (A) Verification of the cleavage activity of rhADAM10 catalytic domain towards the fluorogenic peptide Mca-K-P-L-G-L-Dpa-A-R-NH 2 . The peptide was used at the final concentration of 10 µM in a total of 100 µl reaction mixture with 10 ng of the rhADAM10. The cleavage was allowed to proceed for 30, 40, 50 and 120 min. Time-related increase of the fluorescence emitted from the peptide proves that rhADAM10 was active in comparison to negative control without rhADAM10. (B) ELISA analysis of CA IX ECD in culture medium obtained from CHOwt-FL-CA IX and CHOwt-NS-CA IX cells transiently expressing FL-CA IX and NS-CA IX, respectively. Transfected cells were treated with rhADAM10 (500 ng/ml) for 24 h (Data were analyzed by Student's t-test). (C) Incubation of CHOwt-FL-CA IX cells with ADAM17 activator PMA (20 µM, 3 h), ADAM10 activator IONO (1 µg/ml, 3 h) or rhADAM10 (500 ng/ml, 24 h). Data were analyzed using one-way ANOVA followed by Dunnett's test. Experiments were performed in triplicates and repeated twice. The results were expressed as the mean ± SD. **P<0.01 and ***P<0.001. ADAM, a disintegrin and metalloproteinase; CA IX, carbonic anhydrase IX; rhADAM10, recombinant human ADAM10; ECD, ectodomain; FL, full-length; NS, non-shed; IONO, ionomycin; PMA, phorbol 12-myristate 13-acetate; ns, non-significant.
    Figure Legend Snippet: Biochemical evidence for ADAM10-mediated CA IX ECD cleavage. (A) Verification of the cleavage activity of rhADAM10 catalytic domain towards the fluorogenic peptide Mca-K-P-L-G-L-Dpa-A-R-NH 2 . The peptide was used at the final concentration of 10 µM in a total of 100 µl reaction mixture with 10 ng of the rhADAM10. The cleavage was allowed to proceed for 30, 40, 50 and 120 min. Time-related increase of the fluorescence emitted from the peptide proves that rhADAM10 was active in comparison to negative control without rhADAM10. (B) ELISA analysis of CA IX ECD in culture medium obtained from CHOwt-FL-CA IX and CHOwt-NS-CA IX cells transiently expressing FL-CA IX and NS-CA IX, respectively. Transfected cells were treated with rhADAM10 (500 ng/ml) for 24 h (Data were analyzed by Student's t-test). (C) Incubation of CHOwt-FL-CA IX cells with ADAM17 activator PMA (20 µM, 3 h), ADAM10 activator IONO (1 µg/ml, 3 h) or rhADAM10 (500 ng/ml, 24 h). Data were analyzed using one-way ANOVA followed by Dunnett's test. Experiments were performed in triplicates and repeated twice. The results were expressed as the mean ± SD. **P<0.01 and ***P<0.001. ADAM, a disintegrin and metalloproteinase; CA IX, carbonic anhydrase IX; rhADAM10, recombinant human ADAM10; ECD, ectodomain; FL, full-length; NS, non-shed; IONO, ionomycin; PMA, phorbol 12-myristate 13-acetate; ns, non-significant.

    Techniques Used: Activity Assay, Concentration Assay, Fluorescence, Comparison, Negative Control, Enzyme-linked Immunosorbent Assay, Expressing, Transfection, Incubation, Recombinant

    Co-localization of ADAM10 and CA IX in C33a-FL-CA IX cells. Immunofluorescence of (A) C33a-FL-CA IX cells expressing CA IX, and (B) control C33a-neo cells using ADAM10-specific antibody. Nuclei were counterstained with DAPI. PLA performed in (C) C33a-FL-CA IX and (D) C33a-neo cells using rabbit anti-human CA IX-specific antibody and mouse anti-human ADAM10 antibody. Red PLA signal indicating the interaction of CA IX with ADAM10 was clearly visible only in C33a cells expressing FL CA IX. Experiment was performed in triplicates and repeated twice. Magnification, ×630. Scale bar, 10 µm. ADAM, a disintegrin and metalloproteinase; CA IX, carbonic anhydrase IX; PLA, proximity ligation assay; FL, full-length.
    Figure Legend Snippet: Co-localization of ADAM10 and CA IX in C33a-FL-CA IX cells. Immunofluorescence of (A) C33a-FL-CA IX cells expressing CA IX, and (B) control C33a-neo cells using ADAM10-specific antibody. Nuclei were counterstained with DAPI. PLA performed in (C) C33a-FL-CA IX and (D) C33a-neo cells using rabbit anti-human CA IX-specific antibody and mouse anti-human ADAM10 antibody. Red PLA signal indicating the interaction of CA IX with ADAM10 was clearly visible only in C33a cells expressing FL CA IX. Experiment was performed in triplicates and repeated twice. Magnification, ×630. Scale bar, 10 µm. ADAM, a disintegrin and metalloproteinase; CA IX, carbonic anhydrase IX; PLA, proximity ligation assay; FL, full-length.

    Techniques Used: Immunofluorescence, Expressing, Control, Proximity Ligation Assay

    Localization of ADAM10 (green) in response to CA9hu-1 antibody-induced CA IX internalization (red). C33a-FL-CA IX cells were pre-incubated either with anti-ADAM10 antibody alone (ctrl, A-D) or with anti-ADAM10 antibody together with the internalization-inducing anti-CA IX antibody CA9hu-1 (E-H) 30 min at 4°C. Plasma membrane staining signal for ADAM10 and CA IX was observed at all time points in the absence of CA9hu-1 pre-treatment. On the other hand, CA9hu-1-induced internalization of CA IX as well as ADAM10 was visible after 2 and 4 h at 37°C (E and F), while both molecules showed recycling to plasma membrane after 8 and 24 h. Overlapped staining signals were evident in all samples. Magnification, ×630. Scale bar, 20 µm. Experiment was performed in triplicates and repeated twice. ADAM, a disintegrin and metalloproteinase; CA IX, carbonic anhydrase IX.
    Figure Legend Snippet: Localization of ADAM10 (green) in response to CA9hu-1 antibody-induced CA IX internalization (red). C33a-FL-CA IX cells were pre-incubated either with anti-ADAM10 antibody alone (ctrl, A-D) or with anti-ADAM10 antibody together with the internalization-inducing anti-CA IX antibody CA9hu-1 (E-H) 30 min at 4°C. Plasma membrane staining signal for ADAM10 and CA IX was observed at all time points in the absence of CA9hu-1 pre-treatment. On the other hand, CA9hu-1-induced internalization of CA IX as well as ADAM10 was visible after 2 and 4 h at 37°C (E and F), while both molecules showed recycling to plasma membrane after 8 and 24 h. Overlapped staining signals were evident in all samples. Magnification, ×630. Scale bar, 20 µm. Experiment was performed in triplicates and repeated twice. ADAM, a disintegrin and metalloproteinase; CA IX, carbonic anhydrase IX.

    Techniques Used: Incubation, Clinical Proteomics, Membrane, Staining

    GI-induced internalization of ADAM10 and targeting of ADAM10 by RNA interference or by a dominant-negative ADAM10 mutant ∆MP. (A-H) C33a-FL-CA IX cells were pre-incubated with anti-ADAM10 antibody at 4°C. (A-D) Cells showed the plasma membrane staining signal for ADAM10 (green) in absence of GI at 37°C. (E-H) GI-induced internalization of ADAM10 was clearly visible as cytoplasmic staining signal in all incubation periods at 37°C. (I) Direct targeting of ADAM10 was performed by RNA interference and (J) expression of a dominant-negative mutant ∆MP with and without GI treatment. Control cells were transfected with either an esiRNA targeting RLUC or an empty vector (pcDNA3.1). Culture media collected from transfected cells incubated in presence and absence of GI for 24 h were collected and subjected to ELISA analysis for detection of CA IX ECD. Experiment was performed in triplicates and repeated six times. Data were analyzed by one-way ANOVA followed by Dunnett's test. Results were expressed as the mean percentage of CA IX ECD shedding with control cells set as 100% ± SD. ***P<0.001. GI, GI254023X; ADAM, a disintegrin and metalloproteinase; ∆MP, dominant-negative mutant of ADAM10; esiRNA, enzymatically-prepared small interfering RNA; CA IX, carbonic anhydrase IX; ECD, ectodomain.
    Figure Legend Snippet: GI-induced internalization of ADAM10 and targeting of ADAM10 by RNA interference or by a dominant-negative ADAM10 mutant ∆MP. (A-H) C33a-FL-CA IX cells were pre-incubated with anti-ADAM10 antibody at 4°C. (A-D) Cells showed the plasma membrane staining signal for ADAM10 (green) in absence of GI at 37°C. (E-H) GI-induced internalization of ADAM10 was clearly visible as cytoplasmic staining signal in all incubation periods at 37°C. (I) Direct targeting of ADAM10 was performed by RNA interference and (J) expression of a dominant-negative mutant ∆MP with and without GI treatment. Control cells were transfected with either an esiRNA targeting RLUC or an empty vector (pcDNA3.1). Culture media collected from transfected cells incubated in presence and absence of GI for 24 h were collected and subjected to ELISA analysis for detection of CA IX ECD. Experiment was performed in triplicates and repeated six times. Data were analyzed by one-way ANOVA followed by Dunnett's test. Results were expressed as the mean percentage of CA IX ECD shedding with control cells set as 100% ± SD. ***P<0.001. GI, GI254023X; ADAM, a disintegrin and metalloproteinase; ∆MP, dominant-negative mutant of ADAM10; esiRNA, enzymatically-prepared small interfering RNA; CA IX, carbonic anhydrase IX; ECD, ectodomain.

    Techniques Used: Dominant Negative Mutation, Mutagenesis, Incubation, Clinical Proteomics, Membrane, Staining, Expressing, Control, Transfection, esiRNA, Plasmid Preparation, Enzyme-linked Immunosorbent Assay, Small Interfering RNA

    Additive effect of ADAM10 and ADAM17 activation/inhibition. (A) Quantitative PCR analysis of ADAM10 and ADAM17 mRNA levels in C33a-FL-CA IX and C33a-NS-CA IX cells normalized to the level of β-actin mRNA. (B) Western blot analysis of ADAM10, ADAM17 and CA IX protein in C33a-FL-CA IX and C33a-NS-CA IX cells. The anti-actin antibody was used as a loading control. (C and D) ELISA analysis of CA IX ECD in culture medium collected from C33-FL-CA IX cells after the treatment with IONO (1 µg/ml), PMA (20 µM), IONO + PMA (1 µg/ml; 20 µM), D1(A12) antibody (200 nM), GI inhibitor (1 µM) or D1(A12) + GI (200 nM; 1 µM) for 3 h in comparison to non-treated cells (CTRL). Experiment was performed in triplicates and repeated two times. Data were analyzed by (A) Student's t-test and (C and D) one-way ANOVA followed by Dunnett's test. Results were expressed as the mean relative levels of mRNA or CA IX ECD ± SD. ***P<0.001. ADAM, a disintegrin and metalloproteinase; FL, full-length; CA IX, carbonic anhydrase IX; NS, non-shed; ECT, ectodomain; IONO, ionomycin; PMA, phorbol 12-myristate 13-acetate; GI, GI254023X.
    Figure Legend Snippet: Additive effect of ADAM10 and ADAM17 activation/inhibition. (A) Quantitative PCR analysis of ADAM10 and ADAM17 mRNA levels in C33a-FL-CA IX and C33a-NS-CA IX cells normalized to the level of β-actin mRNA. (B) Western blot analysis of ADAM10, ADAM17 and CA IX protein in C33a-FL-CA IX and C33a-NS-CA IX cells. The anti-actin antibody was used as a loading control. (C and D) ELISA analysis of CA IX ECD in culture medium collected from C33-FL-CA IX cells after the treatment with IONO (1 µg/ml), PMA (20 µM), IONO + PMA (1 µg/ml; 20 µM), D1(A12) antibody (200 nM), GI inhibitor (1 µM) or D1(A12) + GI (200 nM; 1 µM) for 3 h in comparison to non-treated cells (CTRL). Experiment was performed in triplicates and repeated two times. Data were analyzed by (A) Student's t-test and (C and D) one-way ANOVA followed by Dunnett's test. Results were expressed as the mean relative levels of mRNA or CA IX ECD ± SD. ***P<0.001. ADAM, a disintegrin and metalloproteinase; FL, full-length; CA IX, carbonic anhydrase IX; NS, non-shed; ECT, ectodomain; IONO, ionomycin; PMA, phorbol 12-myristate 13-acetate; GI, GI254023X.

    Techniques Used: Activation Assay, Inhibition, Real-time Polymerase Chain Reaction, Western Blot, Control, Enzyme-linked Immunosorbent Assay, Comparison

    Scheme illustrating CA IX ECD shedding by ADAM10 and ADAM17 proteinases. Picture depicts differences in regulatory components that differentially affect ADAMs biosynthesis and processing at various levels of their expression and activation and thereby can potentially influence CA IX ECD cleavage. Based on ( , – ). CA IX, carbonic anhydrase IX; ADAM, a disintegrin and metalloproteinase; ECD, ectodomain.
    Figure Legend Snippet: Scheme illustrating CA IX ECD shedding by ADAM10 and ADAM17 proteinases. Picture depicts differences in regulatory components that differentially affect ADAMs biosynthesis and processing at various levels of their expression and activation and thereby can potentially influence CA IX ECD cleavage. Based on ( , – ). CA IX, carbonic anhydrase IX; ADAM, a disintegrin and metalloproteinase; ECD, ectodomain.

    Techniques Used: Expressing, Activation Assay

    Related Articles

    Sequencing:

    Article Title: Unbiased proteomic profiling of host cell extracellular vesicle composition and dynamics upon HIV-1 infection.
    Article Snippet: Reagent/Resource Reference or Source Identifier or Catalog Number Experimental Models Jurkat cells This study J77 clone 20 (short tandem repeat profiling) 293-LTV cells Cell Biolabs LTV-100 GHOST X4R5 from NIH AIDS Reagent Program 3943 Recombinant DNA pBR-NL4-3 EGFP-Nef+ (HIV-1) Schindler et al (2005) N/A pCMV-VSV-G Adgene Cat#8454 pPAX2 Adgene Cat#12260 X4GFP (HIV-1) Silvin et al (2017) N/A pLKO.1 sh luciferase Sigma-Aldrich Mission shRNA SHC007 pLKO.1 sh SERINC3_1 (Homo sapiens) Sigma-Aldrich Mission shRNA, TRCN0000115948 pLKO.1 sh SERINC3_2(H. sapiens) Sigma-Aldrich Mission shRNA, TRCN0000115949 pLKO.1 sh SERINC3_3(H. sapiens) Sigma-Aldrich Mission shRNA, TRCN0000293864 Antibodies Mouse anti-human CD63 (clone H5C6) BD Bioscience Cat#557305 Mouse anti-human CD9 (clone MM2/57) Millipore Cat#cbl162 Mouse anti-human CD45 (clone HI30) BD Bioscience Cat#557748 Rat anti-GP96 (clone 9G10) Stressgen Cat# ADI-SPA-850-D Goat anti-human AChE Abcam Cat# ab31276 Mouse anti-human actin (clone C4) Millipore Cat# MAB1501 Rabbit anti-human syntenin-1 (clone C2C3) GeneTex Cat# GTX10847 14 of 25 The EMBO Journal 40: e105492 | 2021 a 2021 The Authors D ow nloaded from https://w w w .em bopress.org on M arch 1, 2024 from IP 2401:4900:1ce0:76a8:8a5:ed69:54e:6d30. .. Reagents and Tools table (continued) Reagent/Resource Reference or Source Identifier or Catalog Number Mouse anti-human CD81 (clone 5A6) Santa Cruz Cat# sc-23692 Rabbit anti-human SERINC3 Abcam Cat#ab153748 Mouse anti-human SPN (clone MEM-59) Abcam Cat#ab9088 Rabbit anti- MOV10 (clone EPR14478) Abcam Cat# ab189919 Mouse anti-human ADAM10 (clone 163003) R&D Systems Cat# MAB1427 Rabbit anti-CD3G (clone EPR4517) Abcam Cat# ab134096 Mouse anti-HIV-1 p24 Monoclonal (183-H12-5C) NIH AIDS reagent program Cat#1513 HRP-conjugated goat anti-rabbit IgG (H + L) Jackson Cat#111-035-144 HRP conjugated goat anti-mouse IgG (H + L) Jackson Cat#111-035-146 HRP-conjugated donkey anti-goat IgG (H + L) Jackson Cat#705-035-147 Rabbit anti-human CD81 (clone EPR21916) Abcam Cat# ab233692 Mouse anti-human CD63 (clone TS63) Diaclone Cat# 857.770.000 Rabbit anti-mouse Sigma Cat#SAB3701080 APC-conjugated anti-human CD3 (clone REA 613) Miltenyi Cat#130-113-697 Oligonucleotides and other sequence-based reagents PCR primers GAPDH forward This study 50ATGTTCGTCATGGGTGTGAA30 PCR primers GAPDH reverse This study 50ATGTTCGTCATGGGTGTGAA30 PCR primers SERINC3 forward This study 50ATTCTAGCATCCGCACTTCC30 PCR primers SERINC3 reverse This study 50CGAGGCTGTCCATCTTCTTC30 Chemicals, enzymes and other reagents RPMI-1640-GlutamaxTM medium Gibco Cat # 11554516 Penicillin-Streptomycin Gibco Cat#11548876 Fetal bovine serum Gibco Batch#42F2567K DMEM-GlutamaxTM Gibco Cat#11594446 GeneticinTM Gibco Cat#11558616 PBS Gibco Cat# 11530546 Hygromycin B Invitrogen Cat#10687010 LymphoPrepTM tubes Axis Shield Cat#11548535 DynabeadsTM Human T-Activator CD3/CD28 for T Cell Expansion and Activation Gibco Cat#111.61D Hepes Gibco Cat#12509079 Non-essential aminoacids Gibco Cat#11140050 Sodium pyruvate Gibco Cat#11360070 IL2 R&D Systems Cat#202-IL-010 Puromycin Invitrogen Cat#A1113803 TransIT-293 reagent Mirus Bio Cat#MIR27906 Fixable viability dye efluor 780 eBioscience Cat#65-0865-14 OptiprepTM, Sigma-Aldrich Cat#D1556 4x Laemmli Sample buffer Biorad Cat#1610747 4–15% Mini-Protean® TGX Stain-FreeTM gels Bio-Rad Cat#4568083 4–15% Mini-Protean® TGX Stain-FreeTM gels Bio-Rad Cat#4568086 Immun-Blot PVDF Bio-Rad Cat#170-4272 Clarity western ECL substrate Bio-Rad Cat#1705061 Formvar Agar Cat#AGR1202 Copper/palladium grids Agar Cat#AGG7262PD Uranyl/acetate LFG Cat#6159-44-0 a 2021 The Authors The EMBO Journal 40: e105492 | 2021 15 of 25 D ow nloaded from https://w w w .em bopress.org on M arch 1, 2024 from IP 2401:4900:1ce0:76a8:8a5:ed69:54e:6d30. .. Reagents and Tools table (continued) Reagent/Resource Reference or Source Identifier or Catalog Number Methyl-cellulose, viscosity:25cP Sigma Cat#M6385 Protein A-gold CMC, UMC Utrecht, Netherlands L-arginine-13C6 Thermo Scientific Cat#88210 L-lysine-4,4,5,5-D4 Thermo Scientific Cat#88437 L-arginine-13C6 15N4 Thermo Scientific Cat#89990 L-lysine-13C6 15N2 Thermo Scientific Cat#88209 Dialyzed Fetal Bovine Serum Thermo Scientific Cat#A3382001 SDS Roth CN30.3 Tris-HCl pH 8.0 Sigma #T6666 Acetone Fischer Chemical #A/0600/17 Acetonitrile Merck Cat#1.00029.1000 Urea Sigma Cat#U5378 Dithiothreitol (DTT) Euromedex Cat#EU0006-B Idodoacetamide Sigma Cat#I6125 LysC Wako #129-02541 Trypsin Promega Cat#V5111 Trifluoroacetic acid (TFA), Sigma Cat#73645 SDB-RPS solid phase extraction material VWR #66886-U 50-cm column with 75-μm inner diameter, packed in-house with 1.8- μm C18 particles Dr. Maisch GmbH C18 column (75 lm inner diameter × 2 cm; nanoViper Acclaim PepMapTM 100, Thermo Scientific Cat#164535 50 cm × 75 lm C18 column (nanoViper Acclaim PepMapTM RSLC, 2 lm, 100 A,) Thermo Scientific Cat#164942 Centrifugal Filter (MWCO = 100 kDa;) Sartorius Cat#VS2061 qEV size-exclusion columns Izon Cat#SP1 Protein A Magnetic Beads Pierce Cat#88846 BS3 Thermo Scientific Cat#A39266 SuperScript II Reverse Transciptase Thermo Scientific Cat#18064022 SYBRgreen ThermoScientific Cat#A25742 Software Image Lab v5.2.1 Biorad Primer3Plus http://www.bioinformatics.nl/cgi-bin/prime r3plus/primer3plus.cgi FlowJo software v10 FlowJo LLC MaxQuant V 1.6.1.13 Cox and Mann (2008) iTEM, Olympus Soft Imaging Solutions GmbH 5.2 Fiji/ImageJ v2.0.0-rc-69/1.52p https://imagej.net/ImageJ Python v3.5+ plus packages (holoviz, panel, pandas, network) https:/www.github.com/JuliaS92/EVProfiler Other CD4+ T Cell Isolation Kit Miltenyi Cat#130-096-533 MACSPlex Exosome Kit, human Miltenyi Cat#130-108-813 Exosome Isolation Kit CD63, human Miltenyi Cat#130-110-918 Exosome Isolation Kit CD81, human Miltenyi Cat#130-111-575 LightCycler®480 Instrument II LifeScience RSLCnano system (Ultimate 3000) Thermo Scientific Cat#ULTIM3000RSLCNANO Orbitrap Fusion Tribrid mass spectrometer Thermo Scientific Cat#IQLAAEGAAPFADBMBCX 16 of 25 The EMBO Journal 40: e105492 | 2021 a 2021 The Authors D ow nloaded from https://w w w .em bopress.org on M arch 1, 2024 from IP 2401:4900:1ce0:76a8:8a5:ed69:54e:6d30.

    Polymerase Chain Reaction:

    Article Title: Unbiased proteomic profiling of host cell extracellular vesicle composition and dynamics upon HIV-1 infection.
    Article Snippet: Reagent/Resource Reference or Source Identifier or Catalog Number Experimental Models Jurkat cells This study J77 clone 20 (short tandem repeat profiling) 293-LTV cells Cell Biolabs LTV-100 GHOST X4R5 from NIH AIDS Reagent Program 3943 Recombinant DNA pBR-NL4-3 EGFP-Nef+ (HIV-1) Schindler et al (2005) N/A pCMV-VSV-G Adgene Cat#8454 pPAX2 Adgene Cat#12260 X4GFP (HIV-1) Silvin et al (2017) N/A pLKO.1 sh luciferase Sigma-Aldrich Mission shRNA SHC007 pLKO.1 sh SERINC3_1 (Homo sapiens) Sigma-Aldrich Mission shRNA, TRCN0000115948 pLKO.1 sh SERINC3_2(H. sapiens) Sigma-Aldrich Mission shRNA, TRCN0000115949 pLKO.1 sh SERINC3_3(H. sapiens) Sigma-Aldrich Mission shRNA, TRCN0000293864 Antibodies Mouse anti-human CD63 (clone H5C6) BD Bioscience Cat#557305 Mouse anti-human CD9 (clone MM2/57) Millipore Cat#cbl162 Mouse anti-human CD45 (clone HI30) BD Bioscience Cat#557748 Rat anti-GP96 (clone 9G10) Stressgen Cat# ADI-SPA-850-D Goat anti-human AChE Abcam Cat# ab31276 Mouse anti-human actin (clone C4) Millipore Cat# MAB1501 Rabbit anti-human syntenin-1 (clone C2C3) GeneTex Cat# GTX10847 14 of 25 The EMBO Journal 40: e105492 | 2021 a 2021 The Authors D ow nloaded from https://w w w .em bopress.org on M arch 1, 2024 from IP 2401:4900:1ce0:76a8:8a5:ed69:54e:6d30. .. Reagents and Tools table (continued) Reagent/Resource Reference or Source Identifier or Catalog Number Mouse anti-human CD81 (clone 5A6) Santa Cruz Cat# sc-23692 Rabbit anti-human SERINC3 Abcam Cat#ab153748 Mouse anti-human SPN (clone MEM-59) Abcam Cat#ab9088 Rabbit anti- MOV10 (clone EPR14478) Abcam Cat# ab189919 Mouse anti-human ADAM10 (clone 163003) R&D Systems Cat# MAB1427 Rabbit anti-CD3G (clone EPR4517) Abcam Cat# ab134096 Mouse anti-HIV-1 p24 Monoclonal (183-H12-5C) NIH AIDS reagent program Cat#1513 HRP-conjugated goat anti-rabbit IgG (H + L) Jackson Cat#111-035-144 HRP conjugated goat anti-mouse IgG (H + L) Jackson Cat#111-035-146 HRP-conjugated donkey anti-goat IgG (H + L) Jackson Cat#705-035-147 Rabbit anti-human CD81 (clone EPR21916) Abcam Cat# ab233692 Mouse anti-human CD63 (clone TS63) Diaclone Cat# 857.770.000 Rabbit anti-mouse Sigma Cat#SAB3701080 APC-conjugated anti-human CD3 (clone REA 613) Miltenyi Cat#130-113-697 Oligonucleotides and other sequence-based reagents PCR primers GAPDH forward This study 50ATGTTCGTCATGGGTGTGAA30 PCR primers GAPDH reverse This study 50ATGTTCGTCATGGGTGTGAA30 PCR primers SERINC3 forward This study 50ATTCTAGCATCCGCACTTCC30 PCR primers SERINC3 reverse This study 50CGAGGCTGTCCATCTTCTTC30 Chemicals, enzymes and other reagents RPMI-1640-GlutamaxTM medium Gibco Cat # 11554516 Penicillin-Streptomycin Gibco Cat#11548876 Fetal bovine serum Gibco Batch#42F2567K DMEM-GlutamaxTM Gibco Cat#11594446 GeneticinTM Gibco Cat#11558616 PBS Gibco Cat# 11530546 Hygromycin B Invitrogen Cat#10687010 LymphoPrepTM tubes Axis Shield Cat#11548535 DynabeadsTM Human T-Activator CD3/CD28 for T Cell Expansion and Activation Gibco Cat#111.61D Hepes Gibco Cat#12509079 Non-essential aminoacids Gibco Cat#11140050 Sodium pyruvate Gibco Cat#11360070 IL2 R&D Systems Cat#202-IL-010 Puromycin Invitrogen Cat#A1113803 TransIT-293 reagent Mirus Bio Cat#MIR27906 Fixable viability dye efluor 780 eBioscience Cat#65-0865-14 OptiprepTM, Sigma-Aldrich Cat#D1556 4x Laemmli Sample buffer Biorad Cat#1610747 4–15% Mini-Protean® TGX Stain-FreeTM gels Bio-Rad Cat#4568083 4–15% Mini-Protean® TGX Stain-FreeTM gels Bio-Rad Cat#4568086 Immun-Blot PVDF Bio-Rad Cat#170-4272 Clarity western ECL substrate Bio-Rad Cat#1705061 Formvar Agar Cat#AGR1202 Copper/palladium grids Agar Cat#AGG7262PD Uranyl/acetate LFG Cat#6159-44-0 a 2021 The Authors The EMBO Journal 40: e105492 | 2021 15 of 25 D ow nloaded from https://w w w .em bopress.org on M arch 1, 2024 from IP 2401:4900:1ce0:76a8:8a5:ed69:54e:6d30. .. Reagents and Tools table (continued) Reagent/Resource Reference or Source Identifier or Catalog Number Methyl-cellulose, viscosity:25cP Sigma Cat#M6385 Protein A-gold CMC, UMC Utrecht, Netherlands L-arginine-13C6 Thermo Scientific Cat#88210 L-lysine-4,4,5,5-D4 Thermo Scientific Cat#88437 L-arginine-13C6 15N4 Thermo Scientific Cat#89990 L-lysine-13C6 15N2 Thermo Scientific Cat#88209 Dialyzed Fetal Bovine Serum Thermo Scientific Cat#A3382001 SDS Roth CN30.3 Tris-HCl pH 8.0 Sigma #T6666 Acetone Fischer Chemical #A/0600/17 Acetonitrile Merck Cat#1.00029.1000 Urea Sigma Cat#U5378 Dithiothreitol (DTT) Euromedex Cat#EU0006-B Idodoacetamide Sigma Cat#I6125 LysC Wako #129-02541 Trypsin Promega Cat#V5111 Trifluoroacetic acid (TFA), Sigma Cat#73645 SDB-RPS solid phase extraction material VWR #66886-U 50-cm column with 75-μm inner diameter, packed in-house with 1.8- μm C18 particles Dr. Maisch GmbH C18 column (75 lm inner diameter × 2 cm; nanoViper Acclaim PepMapTM 100, Thermo Scientific Cat#164535 50 cm × 75 lm C18 column (nanoViper Acclaim PepMapTM RSLC, 2 lm, 100 A,) Thermo Scientific Cat#164942 Centrifugal Filter (MWCO = 100 kDa;) Sartorius Cat#VS2061 qEV size-exclusion columns Izon Cat#SP1 Protein A Magnetic Beads Pierce Cat#88846 BS3 Thermo Scientific Cat#A39266 SuperScript II Reverse Transciptase Thermo Scientific Cat#18064022 SYBRgreen ThermoScientific Cat#A25742 Software Image Lab v5.2.1 Biorad Primer3Plus http://www.bioinformatics.nl/cgi-bin/prime r3plus/primer3plus.cgi FlowJo software v10 FlowJo LLC MaxQuant V 1.6.1.13 Cox and Mann (2008) iTEM, Olympus Soft Imaging Solutions GmbH 5.2 Fiji/ImageJ v2.0.0-rc-69/1.52p https://imagej.net/ImageJ Python v3.5+ plus packages (holoviz, panel, pandas, network) https:/www.github.com/JuliaS92/EVProfiler Other CD4+ T Cell Isolation Kit Miltenyi Cat#130-096-533 MACSPlex Exosome Kit, human Miltenyi Cat#130-108-813 Exosome Isolation Kit CD63, human Miltenyi Cat#130-110-918 Exosome Isolation Kit CD81, human Miltenyi Cat#130-111-575 LightCycler®480 Instrument II LifeScience RSLCnano system (Ultimate 3000) Thermo Scientific Cat#ULTIM3000RSLCNANO Orbitrap Fusion Tribrid mass spectrometer Thermo Scientific Cat#IQLAAEGAAPFADBMBCX 16 of 25 The EMBO Journal 40: e105492 | 2021 a 2021 The Authors D ow nloaded from https://w w w .em bopress.org on M arch 1, 2024 from IP 2401:4900:1ce0:76a8:8a5:ed69:54e:6d30.

    Activation Assay:

    Article Title: Unbiased proteomic profiling of host cell extracellular vesicle composition and dynamics upon HIV-1 infection.
    Article Snippet: Reagent/Resource Reference or Source Identifier or Catalog Number Experimental Models Jurkat cells This study J77 clone 20 (short tandem repeat profiling) 293-LTV cells Cell Biolabs LTV-100 GHOST X4R5 from NIH AIDS Reagent Program 3943 Recombinant DNA pBR-NL4-3 EGFP-Nef+ (HIV-1) Schindler et al (2005) N/A pCMV-VSV-G Adgene Cat#8454 pPAX2 Adgene Cat#12260 X4GFP (HIV-1) Silvin et al (2017) N/A pLKO.1 sh luciferase Sigma-Aldrich Mission shRNA SHC007 pLKO.1 sh SERINC3_1 (Homo sapiens) Sigma-Aldrich Mission shRNA, TRCN0000115948 pLKO.1 sh SERINC3_2(H. sapiens) Sigma-Aldrich Mission shRNA, TRCN0000115949 pLKO.1 sh SERINC3_3(H. sapiens) Sigma-Aldrich Mission shRNA, TRCN0000293864 Antibodies Mouse anti-human CD63 (clone H5C6) BD Bioscience Cat#557305 Mouse anti-human CD9 (clone MM2/57) Millipore Cat#cbl162 Mouse anti-human CD45 (clone HI30) BD Bioscience Cat#557748 Rat anti-GP96 (clone 9G10) Stressgen Cat# ADI-SPA-850-D Goat anti-human AChE Abcam Cat# ab31276 Mouse anti-human actin (clone C4) Millipore Cat# MAB1501 Rabbit anti-human syntenin-1 (clone C2C3) GeneTex Cat# GTX10847 14 of 25 The EMBO Journal 40: e105492 | 2021 a 2021 The Authors D ow nloaded from https://w w w .em bopress.org on M arch 1, 2024 from IP 2401:4900:1ce0:76a8:8a5:ed69:54e:6d30. .. Reagents and Tools table (continued) Reagent/Resource Reference or Source Identifier or Catalog Number Mouse anti-human CD81 (clone 5A6) Santa Cruz Cat# sc-23692 Rabbit anti-human SERINC3 Abcam Cat#ab153748 Mouse anti-human SPN (clone MEM-59) Abcam Cat#ab9088 Rabbit anti- MOV10 (clone EPR14478) Abcam Cat# ab189919 Mouse anti-human ADAM10 (clone 163003) R&D Systems Cat# MAB1427 Rabbit anti-CD3G (clone EPR4517) Abcam Cat# ab134096 Mouse anti-HIV-1 p24 Monoclonal (183-H12-5C) NIH AIDS reagent program Cat#1513 HRP-conjugated goat anti-rabbit IgG (H + L) Jackson Cat#111-035-144 HRP conjugated goat anti-mouse IgG (H + L) Jackson Cat#111-035-146 HRP-conjugated donkey anti-goat IgG (H + L) Jackson Cat#705-035-147 Rabbit anti-human CD81 (clone EPR21916) Abcam Cat# ab233692 Mouse anti-human CD63 (clone TS63) Diaclone Cat# 857.770.000 Rabbit anti-mouse Sigma Cat#SAB3701080 APC-conjugated anti-human CD3 (clone REA 613) Miltenyi Cat#130-113-697 Oligonucleotides and other sequence-based reagents PCR primers GAPDH forward This study 50ATGTTCGTCATGGGTGTGAA30 PCR primers GAPDH reverse This study 50ATGTTCGTCATGGGTGTGAA30 PCR primers SERINC3 forward This study 50ATTCTAGCATCCGCACTTCC30 PCR primers SERINC3 reverse This study 50CGAGGCTGTCCATCTTCTTC30 Chemicals, enzymes and other reagents RPMI-1640-GlutamaxTM medium Gibco Cat # 11554516 Penicillin-Streptomycin Gibco Cat#11548876 Fetal bovine serum Gibco Batch#42F2567K DMEM-GlutamaxTM Gibco Cat#11594446 GeneticinTM Gibco Cat#11558616 PBS Gibco Cat# 11530546 Hygromycin B Invitrogen Cat#10687010 LymphoPrepTM tubes Axis Shield Cat#11548535 DynabeadsTM Human T-Activator CD3/CD28 for T Cell Expansion and Activation Gibco Cat#111.61D Hepes Gibco Cat#12509079 Non-essential aminoacids Gibco Cat#11140050 Sodium pyruvate Gibco Cat#11360070 IL2 R&D Systems Cat#202-IL-010 Puromycin Invitrogen Cat#A1113803 TransIT-293 reagent Mirus Bio Cat#MIR27906 Fixable viability dye efluor 780 eBioscience Cat#65-0865-14 OptiprepTM, Sigma-Aldrich Cat#D1556 4x Laemmli Sample buffer Biorad Cat#1610747 4–15% Mini-Protean® TGX Stain-FreeTM gels Bio-Rad Cat#4568083 4–15% Mini-Protean® TGX Stain-FreeTM gels Bio-Rad Cat#4568086 Immun-Blot PVDF Bio-Rad Cat#170-4272 Clarity western ECL substrate Bio-Rad Cat#1705061 Formvar Agar Cat#AGR1202 Copper/palladium grids Agar Cat#AGG7262PD Uranyl/acetate LFG Cat#6159-44-0 a 2021 The Authors The EMBO Journal 40: e105492 | 2021 15 of 25 D ow nloaded from https://w w w .em bopress.org on M arch 1, 2024 from IP 2401:4900:1ce0:76a8:8a5:ed69:54e:6d30. .. Reagents and Tools table (continued) Reagent/Resource Reference or Source Identifier or Catalog Number Methyl-cellulose, viscosity:25cP Sigma Cat#M6385 Protein A-gold CMC, UMC Utrecht, Netherlands L-arginine-13C6 Thermo Scientific Cat#88210 L-lysine-4,4,5,5-D4 Thermo Scientific Cat#88437 L-arginine-13C6 15N4 Thermo Scientific Cat#89990 L-lysine-13C6 15N2 Thermo Scientific Cat#88209 Dialyzed Fetal Bovine Serum Thermo Scientific Cat#A3382001 SDS Roth CN30.3 Tris-HCl pH 8.0 Sigma #T6666 Acetone Fischer Chemical #A/0600/17 Acetonitrile Merck Cat#1.00029.1000 Urea Sigma Cat#U5378 Dithiothreitol (DTT) Euromedex Cat#EU0006-B Idodoacetamide Sigma Cat#I6125 LysC Wako #129-02541 Trypsin Promega Cat#V5111 Trifluoroacetic acid (TFA), Sigma Cat#73645 SDB-RPS solid phase extraction material VWR #66886-U 50-cm column with 75-μm inner diameter, packed in-house with 1.8- μm C18 particles Dr. Maisch GmbH C18 column (75 lm inner diameter × 2 cm; nanoViper Acclaim PepMapTM 100, Thermo Scientific Cat#164535 50 cm × 75 lm C18 column (nanoViper Acclaim PepMapTM RSLC, 2 lm, 100 A,) Thermo Scientific Cat#164942 Centrifugal Filter (MWCO = 100 kDa;) Sartorius Cat#VS2061 qEV size-exclusion columns Izon Cat#SP1 Protein A Magnetic Beads Pierce Cat#88846 BS3 Thermo Scientific Cat#A39266 SuperScript II Reverse Transciptase Thermo Scientific Cat#18064022 SYBRgreen ThermoScientific Cat#A25742 Software Image Lab v5.2.1 Biorad Primer3Plus http://www.bioinformatics.nl/cgi-bin/prime r3plus/primer3plus.cgi FlowJo software v10 FlowJo LLC MaxQuant V 1.6.1.13 Cox and Mann (2008) iTEM, Olympus Soft Imaging Solutions GmbH 5.2 Fiji/ImageJ v2.0.0-rc-69/1.52p https://imagej.net/ImageJ Python v3.5+ plus packages (holoviz, panel, pandas, network) https:/www.github.com/JuliaS92/EVProfiler Other CD4+ T Cell Isolation Kit Miltenyi Cat#130-096-533 MACSPlex Exosome Kit, human Miltenyi Cat#130-108-813 Exosome Isolation Kit CD63, human Miltenyi Cat#130-110-918 Exosome Isolation Kit CD81, human Miltenyi Cat#130-111-575 LightCycler®480 Instrument II LifeScience RSLCnano system (Ultimate 3000) Thermo Scientific Cat#ULTIM3000RSLCNANO Orbitrap Fusion Tribrid mass spectrometer Thermo Scientific Cat#IQLAAEGAAPFADBMBCX 16 of 25 The EMBO Journal 40: e105492 | 2021 a 2021 The Authors D ow nloaded from https://w w w .em bopress.org on M arch 1, 2024 from IP 2401:4900:1ce0:76a8:8a5:ed69:54e:6d30.

    Staining:

    Article Title: Unbiased proteomic profiling of host cell extracellular vesicle composition and dynamics upon HIV-1 infection.
    Article Snippet: Reagent/Resource Reference or Source Identifier or Catalog Number Experimental Models Jurkat cells This study J77 clone 20 (short tandem repeat profiling) 293-LTV cells Cell Biolabs LTV-100 GHOST X4R5 from NIH AIDS Reagent Program 3943 Recombinant DNA pBR-NL4-3 EGFP-Nef+ (HIV-1) Schindler et al (2005) N/A pCMV-VSV-G Adgene Cat#8454 pPAX2 Adgene Cat#12260 X4GFP (HIV-1) Silvin et al (2017) N/A pLKO.1 sh luciferase Sigma-Aldrich Mission shRNA SHC007 pLKO.1 sh SERINC3_1 (Homo sapiens) Sigma-Aldrich Mission shRNA, TRCN0000115948 pLKO.1 sh SERINC3_2(H. sapiens) Sigma-Aldrich Mission shRNA, TRCN0000115949 pLKO.1 sh SERINC3_3(H. sapiens) Sigma-Aldrich Mission shRNA, TRCN0000293864 Antibodies Mouse anti-human CD63 (clone H5C6) BD Bioscience Cat#557305 Mouse anti-human CD9 (clone MM2/57) Millipore Cat#cbl162 Mouse anti-human CD45 (clone HI30) BD Bioscience Cat#557748 Rat anti-GP96 (clone 9G10) Stressgen Cat# ADI-SPA-850-D Goat anti-human AChE Abcam Cat# ab31276 Mouse anti-human actin (clone C4) Millipore Cat# MAB1501 Rabbit anti-human syntenin-1 (clone C2C3) GeneTex Cat# GTX10847 14 of 25 The EMBO Journal 40: e105492 | 2021 a 2021 The Authors D ow nloaded from https://w w w .em bopress.org on M arch 1, 2024 from IP 2401:4900:1ce0:76a8:8a5:ed69:54e:6d30. .. Reagents and Tools table (continued) Reagent/Resource Reference or Source Identifier or Catalog Number Mouse anti-human CD81 (clone 5A6) Santa Cruz Cat# sc-23692 Rabbit anti-human SERINC3 Abcam Cat#ab153748 Mouse anti-human SPN (clone MEM-59) Abcam Cat#ab9088 Rabbit anti- MOV10 (clone EPR14478) Abcam Cat# ab189919 Mouse anti-human ADAM10 (clone 163003) R&D Systems Cat# MAB1427 Rabbit anti-CD3G (clone EPR4517) Abcam Cat# ab134096 Mouse anti-HIV-1 p24 Monoclonal (183-H12-5C) NIH AIDS reagent program Cat#1513 HRP-conjugated goat anti-rabbit IgG (H + L) Jackson Cat#111-035-144 HRP conjugated goat anti-mouse IgG (H + L) Jackson Cat#111-035-146 HRP-conjugated donkey anti-goat IgG (H + L) Jackson Cat#705-035-147 Rabbit anti-human CD81 (clone EPR21916) Abcam Cat# ab233692 Mouse anti-human CD63 (clone TS63) Diaclone Cat# 857.770.000 Rabbit anti-mouse Sigma Cat#SAB3701080 APC-conjugated anti-human CD3 (clone REA 613) Miltenyi Cat#130-113-697 Oligonucleotides and other sequence-based reagents PCR primers GAPDH forward This study 50ATGTTCGTCATGGGTGTGAA30 PCR primers GAPDH reverse This study 50ATGTTCGTCATGGGTGTGAA30 PCR primers SERINC3 forward This study 50ATTCTAGCATCCGCACTTCC30 PCR primers SERINC3 reverse This study 50CGAGGCTGTCCATCTTCTTC30 Chemicals, enzymes and other reagents RPMI-1640-GlutamaxTM medium Gibco Cat # 11554516 Penicillin-Streptomycin Gibco Cat#11548876 Fetal bovine serum Gibco Batch#42F2567K DMEM-GlutamaxTM Gibco Cat#11594446 GeneticinTM Gibco Cat#11558616 PBS Gibco Cat# 11530546 Hygromycin B Invitrogen Cat#10687010 LymphoPrepTM tubes Axis Shield Cat#11548535 DynabeadsTM Human T-Activator CD3/CD28 for T Cell Expansion and Activation Gibco Cat#111.61D Hepes Gibco Cat#12509079 Non-essential aminoacids Gibco Cat#11140050 Sodium pyruvate Gibco Cat#11360070 IL2 R&D Systems Cat#202-IL-010 Puromycin Invitrogen Cat#A1113803 TransIT-293 reagent Mirus Bio Cat#MIR27906 Fixable viability dye efluor 780 eBioscience Cat#65-0865-14 OptiprepTM, Sigma-Aldrich Cat#D1556 4x Laemmli Sample buffer Biorad Cat#1610747 4–15% Mini-Protean® TGX Stain-FreeTM gels Bio-Rad Cat#4568083 4–15% Mini-Protean® TGX Stain-FreeTM gels Bio-Rad Cat#4568086 Immun-Blot PVDF Bio-Rad Cat#170-4272 Clarity western ECL substrate Bio-Rad Cat#1705061 Formvar Agar Cat#AGR1202 Copper/palladium grids Agar Cat#AGG7262PD Uranyl/acetate LFG Cat#6159-44-0 a 2021 The Authors The EMBO Journal 40: e105492 | 2021 15 of 25 D ow nloaded from https://w w w .em bopress.org on M arch 1, 2024 from IP 2401:4900:1ce0:76a8:8a5:ed69:54e:6d30. .. Reagents and Tools table (continued) Reagent/Resource Reference or Source Identifier or Catalog Number Methyl-cellulose, viscosity:25cP Sigma Cat#M6385 Protein A-gold CMC, UMC Utrecht, Netherlands L-arginine-13C6 Thermo Scientific Cat#88210 L-lysine-4,4,5,5-D4 Thermo Scientific Cat#88437 L-arginine-13C6 15N4 Thermo Scientific Cat#89990 L-lysine-13C6 15N2 Thermo Scientific Cat#88209 Dialyzed Fetal Bovine Serum Thermo Scientific Cat#A3382001 SDS Roth CN30.3 Tris-HCl pH 8.0 Sigma #T6666 Acetone Fischer Chemical #A/0600/17 Acetonitrile Merck Cat#1.00029.1000 Urea Sigma Cat#U5378 Dithiothreitol (DTT) Euromedex Cat#EU0006-B Idodoacetamide Sigma Cat#I6125 LysC Wako #129-02541 Trypsin Promega Cat#V5111 Trifluoroacetic acid (TFA), Sigma Cat#73645 SDB-RPS solid phase extraction material VWR #66886-U 50-cm column with 75-μm inner diameter, packed in-house with 1.8- μm C18 particles Dr. Maisch GmbH C18 column (75 lm inner diameter × 2 cm; nanoViper Acclaim PepMapTM 100, Thermo Scientific Cat#164535 50 cm × 75 lm C18 column (nanoViper Acclaim PepMapTM RSLC, 2 lm, 100 A,) Thermo Scientific Cat#164942 Centrifugal Filter (MWCO = 100 kDa;) Sartorius Cat#VS2061 qEV size-exclusion columns Izon Cat#SP1 Protein A Magnetic Beads Pierce Cat#88846 BS3 Thermo Scientific Cat#A39266 SuperScript II Reverse Transciptase Thermo Scientific Cat#18064022 SYBRgreen ThermoScientific Cat#A25742 Software Image Lab v5.2.1 Biorad Primer3Plus http://www.bioinformatics.nl/cgi-bin/prime r3plus/primer3plus.cgi FlowJo software v10 FlowJo LLC MaxQuant V 1.6.1.13 Cox and Mann (2008) iTEM, Olympus Soft Imaging Solutions GmbH 5.2 Fiji/ImageJ v2.0.0-rc-69/1.52p https://imagej.net/ImageJ Python v3.5+ plus packages (holoviz, panel, pandas, network) https:/www.github.com/JuliaS92/EVProfiler Other CD4+ T Cell Isolation Kit Miltenyi Cat#130-096-533 MACSPlex Exosome Kit, human Miltenyi Cat#130-108-813 Exosome Isolation Kit CD63, human Miltenyi Cat#130-110-918 Exosome Isolation Kit CD81, human Miltenyi Cat#130-111-575 LightCycler®480 Instrument II LifeScience RSLCnano system (Ultimate 3000) Thermo Scientific Cat#ULTIM3000RSLCNANO Orbitrap Fusion Tribrid mass spectrometer Thermo Scientific Cat#IQLAAEGAAPFADBMBCX 16 of 25 The EMBO Journal 40: e105492 | 2021 a 2021 The Authors D ow nloaded from https://w w w .em bopress.org on M arch 1, 2024 from IP 2401:4900:1ce0:76a8:8a5:ed69:54e:6d30.

    Western Blot:

    Article Title: Unbiased proteomic profiling of host cell extracellular vesicle composition and dynamics upon HIV-1 infection.
    Article Snippet: Reagent/Resource Reference or Source Identifier or Catalog Number Experimental Models Jurkat cells This study J77 clone 20 (short tandem repeat profiling) 293-LTV cells Cell Biolabs LTV-100 GHOST X4R5 from NIH AIDS Reagent Program 3943 Recombinant DNA pBR-NL4-3 EGFP-Nef+ (HIV-1) Schindler et al (2005) N/A pCMV-VSV-G Adgene Cat#8454 pPAX2 Adgene Cat#12260 X4GFP (HIV-1) Silvin et al (2017) N/A pLKO.1 sh luciferase Sigma-Aldrich Mission shRNA SHC007 pLKO.1 sh SERINC3_1 (Homo sapiens) Sigma-Aldrich Mission shRNA, TRCN0000115948 pLKO.1 sh SERINC3_2(H. sapiens) Sigma-Aldrich Mission shRNA, TRCN0000115949 pLKO.1 sh SERINC3_3(H. sapiens) Sigma-Aldrich Mission shRNA, TRCN0000293864 Antibodies Mouse anti-human CD63 (clone H5C6) BD Bioscience Cat#557305 Mouse anti-human CD9 (clone MM2/57) Millipore Cat#cbl162 Mouse anti-human CD45 (clone HI30) BD Bioscience Cat#557748 Rat anti-GP96 (clone 9G10) Stressgen Cat# ADI-SPA-850-D Goat anti-human AChE Abcam Cat# ab31276 Mouse anti-human actin (clone C4) Millipore Cat# MAB1501 Rabbit anti-human syntenin-1 (clone C2C3) GeneTex Cat# GTX10847 14 of 25 The EMBO Journal 40: e105492 | 2021 a 2021 The Authors D ow nloaded from https://w w w .em bopress.org on M arch 1, 2024 from IP 2401:4900:1ce0:76a8:8a5:ed69:54e:6d30. .. Reagents and Tools table (continued) Reagent/Resource Reference or Source Identifier or Catalog Number Mouse anti-human CD81 (clone 5A6) Santa Cruz Cat# sc-23692 Rabbit anti-human SERINC3 Abcam Cat#ab153748 Mouse anti-human SPN (clone MEM-59) Abcam Cat#ab9088 Rabbit anti- MOV10 (clone EPR14478) Abcam Cat# ab189919 Mouse anti-human ADAM10 (clone 163003) R&D Systems Cat# MAB1427 Rabbit anti-CD3G (clone EPR4517) Abcam Cat# ab134096 Mouse anti-HIV-1 p24 Monoclonal (183-H12-5C) NIH AIDS reagent program Cat#1513 HRP-conjugated goat anti-rabbit IgG (H + L) Jackson Cat#111-035-144 HRP conjugated goat anti-mouse IgG (H + L) Jackson Cat#111-035-146 HRP-conjugated donkey anti-goat IgG (H + L) Jackson Cat#705-035-147 Rabbit anti-human CD81 (clone EPR21916) Abcam Cat# ab233692 Mouse anti-human CD63 (clone TS63) Diaclone Cat# 857.770.000 Rabbit anti-mouse Sigma Cat#SAB3701080 APC-conjugated anti-human CD3 (clone REA 613) Miltenyi Cat#130-113-697 Oligonucleotides and other sequence-based reagents PCR primers GAPDH forward This study 50ATGTTCGTCATGGGTGTGAA30 PCR primers GAPDH reverse This study 50ATGTTCGTCATGGGTGTGAA30 PCR primers SERINC3 forward This study 50ATTCTAGCATCCGCACTTCC30 PCR primers SERINC3 reverse This study 50CGAGGCTGTCCATCTTCTTC30 Chemicals, enzymes and other reagents RPMI-1640-GlutamaxTM medium Gibco Cat # 11554516 Penicillin-Streptomycin Gibco Cat#11548876 Fetal bovine serum Gibco Batch#42F2567K DMEM-GlutamaxTM Gibco Cat#11594446 GeneticinTM Gibco Cat#11558616 PBS Gibco Cat# 11530546 Hygromycin B Invitrogen Cat#10687010 LymphoPrepTM tubes Axis Shield Cat#11548535 DynabeadsTM Human T-Activator CD3/CD28 for T Cell Expansion and Activation Gibco Cat#111.61D Hepes Gibco Cat#12509079 Non-essential aminoacids Gibco Cat#11140050 Sodium pyruvate Gibco Cat#11360070 IL2 R&D Systems Cat#202-IL-010 Puromycin Invitrogen Cat#A1113803 TransIT-293 reagent Mirus Bio Cat#MIR27906 Fixable viability dye efluor 780 eBioscience Cat#65-0865-14 OptiprepTM, Sigma-Aldrich Cat#D1556 4x Laemmli Sample buffer Biorad Cat#1610747 4–15% Mini-Protean® TGX Stain-FreeTM gels Bio-Rad Cat#4568083 4–15% Mini-Protean® TGX Stain-FreeTM gels Bio-Rad Cat#4568086 Immun-Blot PVDF Bio-Rad Cat#170-4272 Clarity western ECL substrate Bio-Rad Cat#1705061 Formvar Agar Cat#AGR1202 Copper/palladium grids Agar Cat#AGG7262PD Uranyl/acetate LFG Cat#6159-44-0 a 2021 The Authors The EMBO Journal 40: e105492 | 2021 15 of 25 D ow nloaded from https://w w w .em bopress.org on M arch 1, 2024 from IP 2401:4900:1ce0:76a8:8a5:ed69:54e:6d30. .. Reagents and Tools table (continued) Reagent/Resource Reference or Source Identifier or Catalog Number Methyl-cellulose, viscosity:25cP Sigma Cat#M6385 Protein A-gold CMC, UMC Utrecht, Netherlands L-arginine-13C6 Thermo Scientific Cat#88210 L-lysine-4,4,5,5-D4 Thermo Scientific Cat#88437 L-arginine-13C6 15N4 Thermo Scientific Cat#89990 L-lysine-13C6 15N2 Thermo Scientific Cat#88209 Dialyzed Fetal Bovine Serum Thermo Scientific Cat#A3382001 SDS Roth CN30.3 Tris-HCl pH 8.0 Sigma #T6666 Acetone Fischer Chemical #A/0600/17 Acetonitrile Merck Cat#1.00029.1000 Urea Sigma Cat#U5378 Dithiothreitol (DTT) Euromedex Cat#EU0006-B Idodoacetamide Sigma Cat#I6125 LysC Wako #129-02541 Trypsin Promega Cat#V5111 Trifluoroacetic acid (TFA), Sigma Cat#73645 SDB-RPS solid phase extraction material VWR #66886-U 50-cm column with 75-μm inner diameter, packed in-house with 1.8- μm C18 particles Dr. Maisch GmbH C18 column (75 lm inner diameter × 2 cm; nanoViper Acclaim PepMapTM 100, Thermo Scientific Cat#164535 50 cm × 75 lm C18 column (nanoViper Acclaim PepMapTM RSLC, 2 lm, 100 A,) Thermo Scientific Cat#164942 Centrifugal Filter (MWCO = 100 kDa;) Sartorius Cat#VS2061 qEV size-exclusion columns Izon Cat#SP1 Protein A Magnetic Beads Pierce Cat#88846 BS3 Thermo Scientific Cat#A39266 SuperScript II Reverse Transciptase Thermo Scientific Cat#18064022 SYBRgreen ThermoScientific Cat#A25742 Software Image Lab v5.2.1 Biorad Primer3Plus http://www.bioinformatics.nl/cgi-bin/prime r3plus/primer3plus.cgi FlowJo software v10 FlowJo LLC MaxQuant V 1.6.1.13 Cox and Mann (2008) iTEM, Olympus Soft Imaging Solutions GmbH 5.2 Fiji/ImageJ v2.0.0-rc-69/1.52p https://imagej.net/ImageJ Python v3.5+ plus packages (holoviz, panel, pandas, network) https:/www.github.com/JuliaS92/EVProfiler Other CD4+ T Cell Isolation Kit Miltenyi Cat#130-096-533 MACSPlex Exosome Kit, human Miltenyi Cat#130-108-813 Exosome Isolation Kit CD63, human Miltenyi Cat#130-110-918 Exosome Isolation Kit CD81, human Miltenyi Cat#130-111-575 LightCycler®480 Instrument II LifeScience RSLCnano system (Ultimate 3000) Thermo Scientific Cat#ULTIM3000RSLCNANO Orbitrap Fusion Tribrid mass spectrometer Thermo Scientific Cat#IQLAAEGAAPFADBMBCX 16 of 25 The EMBO Journal 40: e105492 | 2021 a 2021 The Authors D ow nloaded from https://w w w .em bopress.org on M arch 1, 2024 from IP 2401:4900:1ce0:76a8:8a5:ed69:54e:6d30.

    Article Title: TspanC8 Tetraspanins and A Disintegrin and Metalloprotease 10 (ADAM10) Interact via Their Extracellular Regions
    Article Snippet: .. For Western blotting immunoprecipitation and immunofluorescence microscopy, primary antibodies were mouse anti-FLAG (M2) and rabbit anti-FLAG (Sigma), rabbit anti-HA (Cell Signaling Technologies (CST)), mouse anti-Myc (9B11) and rabbit anti-Myc (CST), mouse anti-human ADAM10, and goat anti-mouse ADAM10 (R&D Systems), mouse anti-CD9 (C9-BB) , mouse anti-human N-cadherin (BD Biosciences), rabbit anti-GFP (ab290), and mouse anti-human calnexin (AF18) (Abcam). .. The new goat anti-Tspan14 polyclonal was generated by Everest Biotech against a C-terminal cytoplasmic region of Tspan14 (SDIEAVKAGHH) that is identical between human and mouse.

    Immunoprecipitation:

    Article Title: TspanC8 Tetraspanins and A Disintegrin and Metalloprotease 10 (ADAM10) Interact via Their Extracellular Regions
    Article Snippet: .. For Western blotting immunoprecipitation and immunofluorescence microscopy, primary antibodies were mouse anti-FLAG (M2) and rabbit anti-FLAG (Sigma), rabbit anti-HA (Cell Signaling Technologies (CST)), mouse anti-Myc (9B11) and rabbit anti-Myc (CST), mouse anti-human ADAM10, and goat anti-mouse ADAM10 (R&D Systems), mouse anti-CD9 (C9-BB) , mouse anti-human N-cadherin (BD Biosciences), rabbit anti-GFP (ab290), and mouse anti-human calnexin (AF18) (Abcam). .. The new goat anti-Tspan14 polyclonal was generated by Everest Biotech against a C-terminal cytoplasmic region of Tspan14 (SDIEAVKAGHH) that is identical between human and mouse.

    Immunofluorescence:

    Article Title: TspanC8 Tetraspanins and A Disintegrin and Metalloprotease 10 (ADAM10) Interact via Their Extracellular Regions
    Article Snippet: .. For Western blotting immunoprecipitation and immunofluorescence microscopy, primary antibodies were mouse anti-FLAG (M2) and rabbit anti-FLAG (Sigma), rabbit anti-HA (Cell Signaling Technologies (CST)), mouse anti-Myc (9B11) and rabbit anti-Myc (CST), mouse anti-human ADAM10, and goat anti-mouse ADAM10 (R&D Systems), mouse anti-CD9 (C9-BB) , mouse anti-human N-cadherin (BD Biosciences), rabbit anti-GFP (ab290), and mouse anti-human calnexin (AF18) (Abcam). .. The new goat anti-Tspan14 polyclonal was generated by Everest Biotech against a C-terminal cytoplasmic region of Tspan14 (SDIEAVKAGHH) that is identical between human and mouse.

    Microscopy:

    Article Title: TspanC8 Tetraspanins and A Disintegrin and Metalloprotease 10 (ADAM10) Interact via Their Extracellular Regions
    Article Snippet: .. For Western blotting immunoprecipitation and immunofluorescence microscopy, primary antibodies were mouse anti-FLAG (M2) and rabbit anti-FLAG (Sigma), rabbit anti-HA (Cell Signaling Technologies (CST)), mouse anti-Myc (9B11) and rabbit anti-Myc (CST), mouse anti-human ADAM10, and goat anti-mouse ADAM10 (R&D Systems), mouse anti-CD9 (C9-BB) , mouse anti-human N-cadherin (BD Biosciences), rabbit anti-GFP (ab290), and mouse anti-human calnexin (AF18) (Abcam). .. The new goat anti-Tspan14 polyclonal was generated by Everest Biotech against a C-terminal cytoplasmic region of Tspan14 (SDIEAVKAGHH) that is identical between human and mouse.



    Similar Products

    96
    Miltenyi Biotec fitc adam10 fitc 33 rea293 130 113 437 miltenyi biotec fitc apc mouse igg1
    Fitc Adam10 Fitc 33 Rea293 130 113 437 Miltenyi Biotec Fitc Apc Mouse Igg1, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+anti+human+adam10/REA+Control+Antibody+(S)%2C+human+IgG1%2C+REAfinity/pm41518059-241-15-20
    Average 96 stars, based on 1 article reviews
    fitc adam10 fitc 33 rea293 130 113 437 miltenyi biotec fitc apc mouse igg1 - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    93
    Diaclone mouse monoclonal anti adam10 11g2

    Mouse Monoclonal Anti Adam10 11g2, supplied by Diaclone, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+anti+human+adam10/Anti-Human+ADAM-10+Monoclonal+Antibody%2C+Azide+Free+Clone+11G2/pmc11383530-20-2-8
    Average 93 stars, based on 1 article reviews
    mouse monoclonal anti adam10 11g2 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    94
    R&D Systems anti human adam10 ecd mouse mab igg2b
    Biochemical evidence for <t>ADAM10-mediated</t> CA IX ECD cleavage. (A) Verification of the cleavage activity of rhADAM10 catalytic domain towards the fluorogenic peptide Mca-K-P-L-G-L-Dpa-A-R-NH 2 . The peptide was used at the final concentration of 10 µM in a total of 100 µl reaction mixture with 10 ng of the rhADAM10. The cleavage was allowed to proceed for 30, 40, 50 and 120 min. Time-related increase of the fluorescence emitted from the peptide proves that rhADAM10 was active in comparison to negative control without rhADAM10. (B) ELISA analysis of CA IX ECD in culture medium obtained from CHOwt-FL-CA IX and CHOwt-NS-CA IX cells transiently expressing FL-CA IX and NS-CA IX, respectively. Transfected cells were treated with rhADAM10 (500 ng/ml) for 24 h (Data were analyzed by Student's t-test). (C) Incubation of CHOwt-FL-CA IX cells with ADAM17 activator PMA (20 µM, 3 h), ADAM10 activator IONO (1 µg/ml, 3 h) or rhADAM10 (500 ng/ml, 24 h). Data were analyzed using one-way ANOVA followed by Dunnett's test. Experiments were performed in triplicates and repeated twice. The results were expressed as the mean ± SD. **P<0.01 and ***P<0.001. ADAM, a disintegrin and metalloproteinase; CA IX, carbonic anhydrase IX; rhADAM10, recombinant human ADAM10; ECD, ectodomain; FL, full-length; NS, non-shed; IONO, ionomycin; PMA, phorbol 12-myristate 13-acetate; ns, non-significant.
    Anti Human Adam10 Ecd Mouse Mab Igg2b, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+anti+human+adam10/Human+ADAM10+Ectodomain+Antibody/pmc09813547-36-12-20
    Average 94 stars, based on 1 article reviews
    anti human adam10 ecd mouse mab igg2b - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    R&D Systems anti adam10 mouse mab1427
    Biochemical evidence for <t>ADAM10-mediated</t> CA IX ECD cleavage. (A) Verification of the cleavage activity of rhADAM10 catalytic domain towards the fluorogenic peptide Mca-K-P-L-G-L-Dpa-A-R-NH 2 . The peptide was used at the final concentration of 10 µM in a total of 100 µl reaction mixture with 10 ng of the rhADAM10. The cleavage was allowed to proceed for 30, 40, 50 and 120 min. Time-related increase of the fluorescence emitted from the peptide proves that rhADAM10 was active in comparison to negative control without rhADAM10. (B) ELISA analysis of CA IX ECD in culture medium obtained from CHOwt-FL-CA IX and CHOwt-NS-CA IX cells transiently expressing FL-CA IX and NS-CA IX, respectively. Transfected cells were treated with rhADAM10 (500 ng/ml) for 24 h (Data were analyzed by Student's t-test). (C) Incubation of CHOwt-FL-CA IX cells with ADAM17 activator PMA (20 µM, 3 h), ADAM10 activator IONO (1 µg/ml, 3 h) or rhADAM10 (500 ng/ml, 24 h). Data were analyzed using one-way ANOVA followed by Dunnett's test. Experiments were performed in triplicates and repeated twice. The results were expressed as the mean ± SD. **P<0.01 and ***P<0.001. ADAM, a disintegrin and metalloproteinase; CA IX, carbonic anhydrase IX; rhADAM10, recombinant human ADAM10; ECD, ectodomain; FL, full-length; NS, non-shed; IONO, ionomycin; PMA, phorbol 12-myristate 13-acetate; ns, non-significant.
    Anti Adam10 Mouse Mab1427, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+anti+human+adam10/Human+ADAM10+Ectodomain+Antibody/pmc09813547-44-13-17
    Average 94 stars, based on 1 article reviews
    anti adam10 mouse mab1427 - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    93
    R&D Systems human adam10 ecd mouse mab igg2b
    Biochemical evidence for <t>ADAM10-mediated</t> CA IX ECD cleavage. (A) Verification of the cleavage activity of rhADAM10 catalytic domain towards the fluorogenic peptide Mca-K-P-L-G-L-Dpa-A-R-NH 2 . The peptide was used at the final concentration of 10 µM in a total of 100 µl reaction mixture with 10 ng of the rhADAM10. The cleavage was allowed to proceed for 30, 40, 50 and 120 min. Time-related increase of the fluorescence emitted from the peptide proves that rhADAM10 was active in comparison to negative control without rhADAM10. (B) ELISA analysis of CA IX ECD in culture medium obtained from CHOwt-FL-CA IX and CHOwt-NS-CA IX cells transiently expressing FL-CA IX and NS-CA IX, respectively. Transfected cells were treated with rhADAM10 (500 ng/ml) for 24 h (Data were analyzed by Student's t-test). (C) Incubation of CHOwt-FL-CA IX cells with ADAM17 activator PMA (20 µM, 3 h), ADAM10 activator IONO (1 µg/ml, 3 h) or rhADAM10 (500 ng/ml, 24 h). Data were analyzed using one-way ANOVA followed by Dunnett's test. Experiments were performed in triplicates and repeated twice. The results were expressed as the mean ± SD. **P<0.01 and ***P<0.001. ADAM, a disintegrin and metalloproteinase; CA IX, carbonic anhydrase IX; rhADAM10, recombinant human ADAM10; ECD, ectodomain; FL, full-length; NS, non-shed; IONO, ionomycin; PMA, phorbol 12-myristate 13-acetate; ns, non-significant.
    Human Adam10 Ecd Mouse Mab Igg2b, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+anti+human+adam10/Human+ADAM10+Ectodomain+Antibody/pm36524367-51-12-20
    Average 93 stars, based on 1 article reviews
    human adam10 ecd mouse mab igg2b - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    R&D Systems adam10 mouse mab1427
    Biochemical evidence for <t>ADAM10-mediated</t> CA IX ECD cleavage. (A) Verification of the cleavage activity of rhADAM10 catalytic domain towards the fluorogenic peptide Mca-K-P-L-G-L-Dpa-A-R-NH 2 . The peptide was used at the final concentration of 10 µM in a total of 100 µl reaction mixture with 10 ng of the rhADAM10. The cleavage was allowed to proceed for 30, 40, 50 and 120 min. Time-related increase of the fluorescence emitted from the peptide proves that rhADAM10 was active in comparison to negative control without rhADAM10. (B) ELISA analysis of CA IX ECD in culture medium obtained from CHOwt-FL-CA IX and CHOwt-NS-CA IX cells transiently expressing FL-CA IX and NS-CA IX, respectively. Transfected cells were treated with rhADAM10 (500 ng/ml) for 24 h (Data were analyzed by Student's t-test). (C) Incubation of CHOwt-FL-CA IX cells with ADAM17 activator PMA (20 µM, 3 h), ADAM10 activator IONO (1 µg/ml, 3 h) or rhADAM10 (500 ng/ml, 24 h). Data were analyzed using one-way ANOVA followed by Dunnett's test. Experiments were performed in triplicates and repeated twice. The results were expressed as the mean ± SD. **P<0.01 and ***P<0.001. ADAM, a disintegrin and metalloproteinase; CA IX, carbonic anhydrase IX; rhADAM10, recombinant human ADAM10; ECD, ectodomain; FL, full-length; NS, non-shed; IONO, ionomycin; PMA, phorbol 12-myristate 13-acetate; ns, non-significant.
    Adam10 Mouse Mab1427, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+anti+human+adam10/Human+ADAM10+Ectodomain+Antibody/pm36524367-66-65-22
    Average 93 stars, based on 1 article reviews
    adam10 mouse mab1427 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    R&D Systems allophycocyanin apc conjugated mouse anti human adam10
    GPVI cleavage is dependent on Tspan15 and Tspan33 in transfected HEK-293T cells. ( Ai ) Wild-type (WT), <t>ADAM10-knockout</t> (A10 KO), Tspan14-knockout (T14 KO), Tspan15-knockout (T15 KO), Tspan33-knockout (T33 KO) and Tspan15/33 double knockout (T15/33 dKO) HEK-293T cells were transfected with expression constructs for C-terminally Myc-tagged human GPVI and FcRγ (+), or empty vector (–). Cells were treated with 2 mM NEM (+), or vehicle control (–) for 30 min prior to harvest. Cells were then lysed in 1% Triton X-100 and lysates subjected to Western blotting with an anti-Myc antibody. ( Aii ) The percentage of cleaved GPVI from Ai was calculated. Error bars represent the standard error of the mean from three independent experiments. Data were arcsine-transformed and statistically analyzed using a two-way ANOVA followed by a Dunnett’s multiple comparison test, compared to their respective WT controls in each stimulation condition (***, p < 0.001; ****, p < 0.0001). ( B ) ADAM10 surface expression on the cell types described in panel A were analyzed by flow cytometry. Geometric mean fluorescence intensity was used to assess surface ADAM10 levels and data were made relative to WT values. Error bars represent the standard error of the mean from three independent experiments. Average geometric mean intensities were arcsine transformed and then statistically analyzed using a one-way ANOVA followed by a Dunnett’s multiple comparison test, compared to WT (****, p < 0.0001). The data shown are from single CRISPR/Cas9 knockout clones, but similar data were generated using a second set of clones generated using different guide RNA sequences (data not shown).
    Allophycocyanin Apc Conjugated Mouse Anti Human Adam10, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+anti+human+adam10/Human+ADAM10+Ectodomain+APC-conjugated+Antibody/pmc08910667-184-13-25
    Average 93 stars, based on 1 article reviews
    allophycocyanin apc conjugated mouse anti human adam10 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    R&D Systems mouse anti human adam10
    GPVI cleavage is dependent on Tspan15 and Tspan33 in transfected HEK-293T cells. ( Ai ) Wild-type (WT), <t>ADAM10-knockout</t> (A10 KO), Tspan14-knockout (T14 KO), Tspan15-knockout (T15 KO), Tspan33-knockout (T33 KO) and Tspan15/33 double knockout (T15/33 dKO) HEK-293T cells were transfected with expression constructs for C-terminally Myc-tagged human GPVI and FcRγ (+), or empty vector (–). Cells were treated with 2 mM NEM (+), or vehicle control (–) for 30 min prior to harvest. Cells were then lysed in 1% Triton X-100 and lysates subjected to Western blotting with an anti-Myc antibody. ( Aii ) The percentage of cleaved GPVI from Ai was calculated. Error bars represent the standard error of the mean from three independent experiments. Data were arcsine-transformed and statistically analyzed using a two-way ANOVA followed by a Dunnett’s multiple comparison test, compared to their respective WT controls in each stimulation condition (***, p < 0.001; ****, p < 0.0001). ( B ) ADAM10 surface expression on the cell types described in panel A were analyzed by flow cytometry. Geometric mean fluorescence intensity was used to assess surface ADAM10 levels and data were made relative to WT values. Error bars represent the standard error of the mean from three independent experiments. Average geometric mean intensities were arcsine transformed and then statistically analyzed using a one-way ANOVA followed by a Dunnett’s multiple comparison test, compared to WT (****, p < 0.0001). The data shown are from single CRISPR/Cas9 knockout clones, but similar data were generated using a second set of clones generated using different guide RNA sequences (data not shown).
    Mouse Anti Human Adam10, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+anti+human+adam10/Human+ADAM10+Ectodomain+Antibody/pm33709510-334-42-47
    Average 93 stars, based on 1 article reviews
    mouse anti human adam10 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    Image Search Results


    Journal: eLife

    Article Title: Proteomic landscape of tunneling nanotubes reveals CD9 and CD81 tetraspanins as key regulators

    doi: 10.7554/eLife.99172

    Figure Lengend Snippet:

    Article Snippet: Antibody , Mouse monoclonal anti-ADAM10 11G2 , , Diaclone: #857.800.000 , WB (1/1000).

    Techniques: Transfection, Construct, Expressing, Plasmid Preparation, Marker, Sequencing, Purification, Transduction, Control, Software, Staining

    Biochemical evidence for ADAM10-mediated CA IX ECD cleavage. (A) Verification of the cleavage activity of rhADAM10 catalytic domain towards the fluorogenic peptide Mca-K-P-L-G-L-Dpa-A-R-NH 2 . The peptide was used at the final concentration of 10 µM in a total of 100 µl reaction mixture with 10 ng of the rhADAM10. The cleavage was allowed to proceed for 30, 40, 50 and 120 min. Time-related increase of the fluorescence emitted from the peptide proves that rhADAM10 was active in comparison to negative control without rhADAM10. (B) ELISA analysis of CA IX ECD in culture medium obtained from CHOwt-FL-CA IX and CHOwt-NS-CA IX cells transiently expressing FL-CA IX and NS-CA IX, respectively. Transfected cells were treated with rhADAM10 (500 ng/ml) for 24 h (Data were analyzed by Student's t-test). (C) Incubation of CHOwt-FL-CA IX cells with ADAM17 activator PMA (20 µM, 3 h), ADAM10 activator IONO (1 µg/ml, 3 h) or rhADAM10 (500 ng/ml, 24 h). Data were analyzed using one-way ANOVA followed by Dunnett's test. Experiments were performed in triplicates and repeated twice. The results were expressed as the mean ± SD. **P<0.01 and ***P<0.001. ADAM, a disintegrin and metalloproteinase; CA IX, carbonic anhydrase IX; rhADAM10, recombinant human ADAM10; ECD, ectodomain; FL, full-length; NS, non-shed; IONO, ionomycin; PMA, phorbol 12-myristate 13-acetate; ns, non-significant.

    Journal: Oncology Reports

    Article Title: ADAM10 mediates shedding of carbonic anhydrase IX ectodomain non-redundantly to ADAM17

    doi: 10.3892/or.2022.8464

    Figure Lengend Snippet: Biochemical evidence for ADAM10-mediated CA IX ECD cleavage. (A) Verification of the cleavage activity of rhADAM10 catalytic domain towards the fluorogenic peptide Mca-K-P-L-G-L-Dpa-A-R-NH 2 . The peptide was used at the final concentration of 10 µM in a total of 100 µl reaction mixture with 10 ng of the rhADAM10. The cleavage was allowed to proceed for 30, 40, 50 and 120 min. Time-related increase of the fluorescence emitted from the peptide proves that rhADAM10 was active in comparison to negative control without rhADAM10. (B) ELISA analysis of CA IX ECD in culture medium obtained from CHOwt-FL-CA IX and CHOwt-NS-CA IX cells transiently expressing FL-CA IX and NS-CA IX, respectively. Transfected cells were treated with rhADAM10 (500 ng/ml) for 24 h (Data were analyzed by Student's t-test). (C) Incubation of CHOwt-FL-CA IX cells with ADAM17 activator PMA (20 µM, 3 h), ADAM10 activator IONO (1 µg/ml, 3 h) or rhADAM10 (500 ng/ml, 24 h). Data were analyzed using one-way ANOVA followed by Dunnett's test. Experiments were performed in triplicates and repeated twice. The results were expressed as the mean ± SD. **P<0.01 and ***P<0.001. ADAM, a disintegrin and metalloproteinase; CA IX, carbonic anhydrase IX; rhADAM10, recombinant human ADAM10; ECD, ectodomain; FL, full-length; NS, non-shed; IONO, ionomycin; PMA, phorbol 12-myristate 13-acetate; ns, non-significant.

    Article Snippet: For detection of ADAM10, cells cultured on glass coverslips were incubated with anti-human ADAM10 ECD mouse Mab IgG2B Clone 163003 (R&D Systems, Inc.; cat. no. MAB1427, 1:100 in cultivation medium) for 1 h at 37°C, gently washed with PBS and fixed with methanol for 5 min at −20°C.

    Techniques: Activity Assay, Concentration Assay, Fluorescence, Comparison, Negative Control, Enzyme-linked Immunosorbent Assay, Expressing, Transfection, Incubation, Recombinant

    Co-localization of ADAM10 and CA IX in C33a-FL-CA IX cells. Immunofluorescence of (A) C33a-FL-CA IX cells expressing CA IX, and (B) control C33a-neo cells using ADAM10-specific antibody. Nuclei were counterstained with DAPI. PLA performed in (C) C33a-FL-CA IX and (D) C33a-neo cells using rabbit anti-human CA IX-specific antibody and mouse anti-human ADAM10 antibody. Red PLA signal indicating the interaction of CA IX with ADAM10 was clearly visible only in C33a cells expressing FL CA IX. Experiment was performed in triplicates and repeated twice. Magnification, ×630. Scale bar, 10 µm. ADAM, a disintegrin and metalloproteinase; CA IX, carbonic anhydrase IX; PLA, proximity ligation assay; FL, full-length.

    Journal: Oncology Reports

    Article Title: ADAM10 mediates shedding of carbonic anhydrase IX ectodomain non-redundantly to ADAM17

    doi: 10.3892/or.2022.8464

    Figure Lengend Snippet: Co-localization of ADAM10 and CA IX in C33a-FL-CA IX cells. Immunofluorescence of (A) C33a-FL-CA IX cells expressing CA IX, and (B) control C33a-neo cells using ADAM10-specific antibody. Nuclei were counterstained with DAPI. PLA performed in (C) C33a-FL-CA IX and (D) C33a-neo cells using rabbit anti-human CA IX-specific antibody and mouse anti-human ADAM10 antibody. Red PLA signal indicating the interaction of CA IX with ADAM10 was clearly visible only in C33a cells expressing FL CA IX. Experiment was performed in triplicates and repeated twice. Magnification, ×630. Scale bar, 10 µm. ADAM, a disintegrin and metalloproteinase; CA IX, carbonic anhydrase IX; PLA, proximity ligation assay; FL, full-length.

    Article Snippet: For detection of ADAM10, cells cultured on glass coverslips were incubated with anti-human ADAM10 ECD mouse Mab IgG2B Clone 163003 (R&D Systems, Inc.; cat. no. MAB1427, 1:100 in cultivation medium) for 1 h at 37°C, gently washed with PBS and fixed with methanol for 5 min at −20°C.

    Techniques: Immunofluorescence, Expressing, Control, Proximity Ligation Assay

    Localization of ADAM10 (green) in response to CA9hu-1 antibody-induced CA IX internalization (red). C33a-FL-CA IX cells were pre-incubated either with anti-ADAM10 antibody alone (ctrl, A-D) or with anti-ADAM10 antibody together with the internalization-inducing anti-CA IX antibody CA9hu-1 (E-H) 30 min at 4°C. Plasma membrane staining signal for ADAM10 and CA IX was observed at all time points in the absence of CA9hu-1 pre-treatment. On the other hand, CA9hu-1-induced internalization of CA IX as well as ADAM10 was visible after 2 and 4 h at 37°C (E and F), while both molecules showed recycling to plasma membrane after 8 and 24 h. Overlapped staining signals were evident in all samples. Magnification, ×630. Scale bar, 20 µm. Experiment was performed in triplicates and repeated twice. ADAM, a disintegrin and metalloproteinase; CA IX, carbonic anhydrase IX.

    Journal: Oncology Reports

    Article Title: ADAM10 mediates shedding of carbonic anhydrase IX ectodomain non-redundantly to ADAM17

    doi: 10.3892/or.2022.8464

    Figure Lengend Snippet: Localization of ADAM10 (green) in response to CA9hu-1 antibody-induced CA IX internalization (red). C33a-FL-CA IX cells were pre-incubated either with anti-ADAM10 antibody alone (ctrl, A-D) or with anti-ADAM10 antibody together with the internalization-inducing anti-CA IX antibody CA9hu-1 (E-H) 30 min at 4°C. Plasma membrane staining signal for ADAM10 and CA IX was observed at all time points in the absence of CA9hu-1 pre-treatment. On the other hand, CA9hu-1-induced internalization of CA IX as well as ADAM10 was visible after 2 and 4 h at 37°C (E and F), while both molecules showed recycling to plasma membrane after 8 and 24 h. Overlapped staining signals were evident in all samples. Magnification, ×630. Scale bar, 20 µm. Experiment was performed in triplicates and repeated twice. ADAM, a disintegrin and metalloproteinase; CA IX, carbonic anhydrase IX.

    Article Snippet: For detection of ADAM10, cells cultured on glass coverslips were incubated with anti-human ADAM10 ECD mouse Mab IgG2B Clone 163003 (R&D Systems, Inc.; cat. no. MAB1427, 1:100 in cultivation medium) for 1 h at 37°C, gently washed with PBS and fixed with methanol for 5 min at −20°C.

    Techniques: Incubation, Clinical Proteomics, Membrane, Staining

    GI-induced internalization of ADAM10 and targeting of ADAM10 by RNA interference or by a dominant-negative ADAM10 mutant ∆MP. (A-H) C33a-FL-CA IX cells were pre-incubated with anti-ADAM10 antibody at 4°C. (A-D) Cells showed the plasma membrane staining signal for ADAM10 (green) in absence of GI at 37°C. (E-H) GI-induced internalization of ADAM10 was clearly visible as cytoplasmic staining signal in all incubation periods at 37°C. (I) Direct targeting of ADAM10 was performed by RNA interference and (J) expression of a dominant-negative mutant ∆MP with and without GI treatment. Control cells were transfected with either an esiRNA targeting RLUC or an empty vector (pcDNA3.1). Culture media collected from transfected cells incubated in presence and absence of GI for 24 h were collected and subjected to ELISA analysis for detection of CA IX ECD. Experiment was performed in triplicates and repeated six times. Data were analyzed by one-way ANOVA followed by Dunnett's test. Results were expressed as the mean percentage of CA IX ECD shedding with control cells set as 100% ± SD. ***P<0.001. GI, GI254023X; ADAM, a disintegrin and metalloproteinase; ∆MP, dominant-negative mutant of ADAM10; esiRNA, enzymatically-prepared small interfering RNA; CA IX, carbonic anhydrase IX; ECD, ectodomain.

    Journal: Oncology Reports

    Article Title: ADAM10 mediates shedding of carbonic anhydrase IX ectodomain non-redundantly to ADAM17

    doi: 10.3892/or.2022.8464

    Figure Lengend Snippet: GI-induced internalization of ADAM10 and targeting of ADAM10 by RNA interference or by a dominant-negative ADAM10 mutant ∆MP. (A-H) C33a-FL-CA IX cells were pre-incubated with anti-ADAM10 antibody at 4°C. (A-D) Cells showed the plasma membrane staining signal for ADAM10 (green) in absence of GI at 37°C. (E-H) GI-induced internalization of ADAM10 was clearly visible as cytoplasmic staining signal in all incubation periods at 37°C. (I) Direct targeting of ADAM10 was performed by RNA interference and (J) expression of a dominant-negative mutant ∆MP with and without GI treatment. Control cells were transfected with either an esiRNA targeting RLUC or an empty vector (pcDNA3.1). Culture media collected from transfected cells incubated in presence and absence of GI for 24 h were collected and subjected to ELISA analysis for detection of CA IX ECD. Experiment was performed in triplicates and repeated six times. Data were analyzed by one-way ANOVA followed by Dunnett's test. Results were expressed as the mean percentage of CA IX ECD shedding with control cells set as 100% ± SD. ***P<0.001. GI, GI254023X; ADAM, a disintegrin and metalloproteinase; ∆MP, dominant-negative mutant of ADAM10; esiRNA, enzymatically-prepared small interfering RNA; CA IX, carbonic anhydrase IX; ECD, ectodomain.

    Article Snippet: For detection of ADAM10, cells cultured on glass coverslips were incubated with anti-human ADAM10 ECD mouse Mab IgG2B Clone 163003 (R&D Systems, Inc.; cat. no. MAB1427, 1:100 in cultivation medium) for 1 h at 37°C, gently washed with PBS and fixed with methanol for 5 min at −20°C.

    Techniques: Dominant Negative Mutation, Mutagenesis, Incubation, Clinical Proteomics, Membrane, Staining, Expressing, Control, Transfection, esiRNA, Plasmid Preparation, Enzyme-linked Immunosorbent Assay, Small Interfering RNA

    Additive effect of ADAM10 and ADAM17 activation/inhibition. (A) Quantitative PCR analysis of ADAM10 and ADAM17 mRNA levels in C33a-FL-CA IX and C33a-NS-CA IX cells normalized to the level of β-actin mRNA. (B) Western blot analysis of ADAM10, ADAM17 and CA IX protein in C33a-FL-CA IX and C33a-NS-CA IX cells. The anti-actin antibody was used as a loading control. (C and D) ELISA analysis of CA IX ECD in culture medium collected from C33-FL-CA IX cells after the treatment with IONO (1 µg/ml), PMA (20 µM), IONO + PMA (1 µg/ml; 20 µM), D1(A12) antibody (200 nM), GI inhibitor (1 µM) or D1(A12) + GI (200 nM; 1 µM) for 3 h in comparison to non-treated cells (CTRL). Experiment was performed in triplicates and repeated two times. Data were analyzed by (A) Student's t-test and (C and D) one-way ANOVA followed by Dunnett's test. Results were expressed as the mean relative levels of mRNA or CA IX ECD ± SD. ***P<0.001. ADAM, a disintegrin and metalloproteinase; FL, full-length; CA IX, carbonic anhydrase IX; NS, non-shed; ECT, ectodomain; IONO, ionomycin; PMA, phorbol 12-myristate 13-acetate; GI, GI254023X.

    Journal: Oncology Reports

    Article Title: ADAM10 mediates shedding of carbonic anhydrase IX ectodomain non-redundantly to ADAM17

    doi: 10.3892/or.2022.8464

    Figure Lengend Snippet: Additive effect of ADAM10 and ADAM17 activation/inhibition. (A) Quantitative PCR analysis of ADAM10 and ADAM17 mRNA levels in C33a-FL-CA IX and C33a-NS-CA IX cells normalized to the level of β-actin mRNA. (B) Western blot analysis of ADAM10, ADAM17 and CA IX protein in C33a-FL-CA IX and C33a-NS-CA IX cells. The anti-actin antibody was used as a loading control. (C and D) ELISA analysis of CA IX ECD in culture medium collected from C33-FL-CA IX cells after the treatment with IONO (1 µg/ml), PMA (20 µM), IONO + PMA (1 µg/ml; 20 µM), D1(A12) antibody (200 nM), GI inhibitor (1 µM) or D1(A12) + GI (200 nM; 1 µM) for 3 h in comparison to non-treated cells (CTRL). Experiment was performed in triplicates and repeated two times. Data were analyzed by (A) Student's t-test and (C and D) one-way ANOVA followed by Dunnett's test. Results were expressed as the mean relative levels of mRNA or CA IX ECD ± SD. ***P<0.001. ADAM, a disintegrin and metalloproteinase; FL, full-length; CA IX, carbonic anhydrase IX; NS, non-shed; ECT, ectodomain; IONO, ionomycin; PMA, phorbol 12-myristate 13-acetate; GI, GI254023X.

    Article Snippet: For detection of ADAM10, cells cultured on glass coverslips were incubated with anti-human ADAM10 ECD mouse Mab IgG2B Clone 163003 (R&D Systems, Inc.; cat. no. MAB1427, 1:100 in cultivation medium) for 1 h at 37°C, gently washed with PBS and fixed with methanol for 5 min at −20°C.

    Techniques: Activation Assay, Inhibition, Real-time Polymerase Chain Reaction, Western Blot, Control, Enzyme-linked Immunosorbent Assay, Comparison

    Scheme illustrating CA IX ECD shedding by ADAM10 and ADAM17 proteinases. Picture depicts differences in regulatory components that differentially affect ADAMs biosynthesis and processing at various levels of their expression and activation and thereby can potentially influence CA IX ECD cleavage. Based on ( , – ). CA IX, carbonic anhydrase IX; ADAM, a disintegrin and metalloproteinase; ECD, ectodomain.

    Journal: Oncology Reports

    Article Title: ADAM10 mediates shedding of carbonic anhydrase IX ectodomain non-redundantly to ADAM17

    doi: 10.3892/or.2022.8464

    Figure Lengend Snippet: Scheme illustrating CA IX ECD shedding by ADAM10 and ADAM17 proteinases. Picture depicts differences in regulatory components that differentially affect ADAMs biosynthesis and processing at various levels of their expression and activation and thereby can potentially influence CA IX ECD cleavage. Based on ( , – ). CA IX, carbonic anhydrase IX; ADAM, a disintegrin and metalloproteinase; ECD, ectodomain.

    Article Snippet: For detection of ADAM10, cells cultured on glass coverslips were incubated with anti-human ADAM10 ECD mouse Mab IgG2B Clone 163003 (R&D Systems, Inc.; cat. no. MAB1427, 1:100 in cultivation medium) for 1 h at 37°C, gently washed with PBS and fixed with methanol for 5 min at −20°C.

    Techniques: Expressing, Activation Assay

    GPVI cleavage is dependent on Tspan15 and Tspan33 in transfected HEK-293T cells. ( Ai ) Wild-type (WT), ADAM10-knockout (A10 KO), Tspan14-knockout (T14 KO), Tspan15-knockout (T15 KO), Tspan33-knockout (T33 KO) and Tspan15/33 double knockout (T15/33 dKO) HEK-293T cells were transfected with expression constructs for C-terminally Myc-tagged human GPVI and FcRγ (+), or empty vector (–). Cells were treated with 2 mM NEM (+), or vehicle control (–) for 30 min prior to harvest. Cells were then lysed in 1% Triton X-100 and lysates subjected to Western blotting with an anti-Myc antibody. ( Aii ) The percentage of cleaved GPVI from Ai was calculated. Error bars represent the standard error of the mean from three independent experiments. Data were arcsine-transformed and statistically analyzed using a two-way ANOVA followed by a Dunnett’s multiple comparison test, compared to their respective WT controls in each stimulation condition (***, p < 0.001; ****, p < 0.0001). ( B ) ADAM10 surface expression on the cell types described in panel A were analyzed by flow cytometry. Geometric mean fluorescence intensity was used to assess surface ADAM10 levels and data were made relative to WT values. Error bars represent the standard error of the mean from three independent experiments. Average geometric mean intensities were arcsine transformed and then statistically analyzed using a one-way ANOVA followed by a Dunnett’s multiple comparison test, compared to WT (****, p < 0.0001). The data shown are from single CRISPR/Cas9 knockout clones, but similar data were generated using a second set of clones generated using different guide RNA sequences (data not shown).

    Journal: International Journal of Molecular Sciences

    Article Title: The Platelet Collagen Receptor GPVI Is Cleaved by Tspan15/ADAM10 and Tspan33/ADAM10 Molecular Scissors

    doi: 10.3390/ijms23052440

    Figure Lengend Snippet: GPVI cleavage is dependent on Tspan15 and Tspan33 in transfected HEK-293T cells. ( Ai ) Wild-type (WT), ADAM10-knockout (A10 KO), Tspan14-knockout (T14 KO), Tspan15-knockout (T15 KO), Tspan33-knockout (T33 KO) and Tspan15/33 double knockout (T15/33 dKO) HEK-293T cells were transfected with expression constructs for C-terminally Myc-tagged human GPVI and FcRγ (+), or empty vector (–). Cells were treated with 2 mM NEM (+), or vehicle control (–) for 30 min prior to harvest. Cells were then lysed in 1% Triton X-100 and lysates subjected to Western blotting with an anti-Myc antibody. ( Aii ) The percentage of cleaved GPVI from Ai was calculated. Error bars represent the standard error of the mean from three independent experiments. Data were arcsine-transformed and statistically analyzed using a two-way ANOVA followed by a Dunnett’s multiple comparison test, compared to their respective WT controls in each stimulation condition (***, p < 0.001; ****, p < 0.0001). ( B ) ADAM10 surface expression on the cell types described in panel A were analyzed by flow cytometry. Geometric mean fluorescence intensity was used to assess surface ADAM10 levels and data were made relative to WT values. Error bars represent the standard error of the mean from three independent experiments. Average geometric mean intensities were arcsine transformed and then statistically analyzed using a one-way ANOVA followed by a Dunnett’s multiple comparison test, compared to WT (****, p < 0.0001). The data shown are from single CRISPR/Cas9 knockout clones, but similar data were generated using a second set of clones generated using different guide RNA sequences (data not shown).

    Article Snippet: For flow cytometry of ADAM10 on HEK-293T, cells were stained with 10 μg/mL allophycocyanin (APC)-conjugated mouse anti-human ADAM10, or the equivalent negative control mouse IgG (R&D Systems, Abingdon, UK).

    Techniques: Transfection, Knock-Out, Double Knockout, Expressing, Construct, Plasmid Preparation, Control, Western Blot, Transformation Assay, Comparison, Flow Cytometry, Fluorescence, CRISPR, Clone Assay, Generated

    Tspan15 and Tspan33 are required for cleavage of endogenous GPVI in HEL cells. ( Ai ) Wild-type (WT), ADAM10-knockout (A10 KO), Tspan14-knockout (T14 KO), Tspan15-knockout (T15 KO), Tspan33-knockout (T33 KO) and GPVI-knockout (GPVI KO) HEL cells were treated with 6.2 ng/mL PMA for 72 h. Cells were stimulated with 2 mM NEM (+) for 1 h before harvest. Cells were lysed in 1% Triton X-100 and separated by SDS-PAGE. Lysates were probed with a mouse anti-human GPVI antibody (11A7), which recognises the extracellular region of GPVI and therefore only the full-length protein (top panel) and a rabbit anti-human GPVI antibody, which recognises the cytoplasmic tail of GPVI (bottom panel). ( Aii ) Relative GPVI cleavage was calculated by normalising the cleaved fragment signal to the full-length GPVI; the NEM-treated WT was arbitrarily set at 100. Error bars represent the standard error of the mean from three independent experiments. Data were normalised by arcsine transformation and statistically analyzed using a two-way ANOVA followed by a Bonferroni multiple comparison test, compared to WT (***, p < 0.001; ****, p < 0.0001). ( Bi ) WT, T33 KO and Tspan15/33 double knockout (T15/33 dKO) HEL cells were treated with PMA and subjected to lysis and Western blotting as described in panel ( Ai ). ( Bii ) Relative GPVI cleaved was quantitated and statistically analyzed as described in panel ( Aii ). ( C ) ADAM10 surface expression on PMA-differentiated cells used in panels A and B were analyzed by flow cytometry and quantitated as described in B. The data shown are from single CRISPR/Cas9 knockout clones, but similar data were generated using a second set of clones generated using different guide RNA sequences (data not shown).

    Journal: International Journal of Molecular Sciences

    Article Title: The Platelet Collagen Receptor GPVI Is Cleaved by Tspan15/ADAM10 and Tspan33/ADAM10 Molecular Scissors

    doi: 10.3390/ijms23052440

    Figure Lengend Snippet: Tspan15 and Tspan33 are required for cleavage of endogenous GPVI in HEL cells. ( Ai ) Wild-type (WT), ADAM10-knockout (A10 KO), Tspan14-knockout (T14 KO), Tspan15-knockout (T15 KO), Tspan33-knockout (T33 KO) and GPVI-knockout (GPVI KO) HEL cells were treated with 6.2 ng/mL PMA for 72 h. Cells were stimulated with 2 mM NEM (+) for 1 h before harvest. Cells were lysed in 1% Triton X-100 and separated by SDS-PAGE. Lysates were probed with a mouse anti-human GPVI antibody (11A7), which recognises the extracellular region of GPVI and therefore only the full-length protein (top panel) and a rabbit anti-human GPVI antibody, which recognises the cytoplasmic tail of GPVI (bottom panel). ( Aii ) Relative GPVI cleavage was calculated by normalising the cleaved fragment signal to the full-length GPVI; the NEM-treated WT was arbitrarily set at 100. Error bars represent the standard error of the mean from three independent experiments. Data were normalised by arcsine transformation and statistically analyzed using a two-way ANOVA followed by a Bonferroni multiple comparison test, compared to WT (***, p < 0.001; ****, p < 0.0001). ( Bi ) WT, T33 KO and Tspan15/33 double knockout (T15/33 dKO) HEL cells were treated with PMA and subjected to lysis and Western blotting as described in panel ( Ai ). ( Bii ) Relative GPVI cleaved was quantitated and statistically analyzed as described in panel ( Aii ). ( C ) ADAM10 surface expression on PMA-differentiated cells used in panels A and B were analyzed by flow cytometry and quantitated as described in B. The data shown are from single CRISPR/Cas9 knockout clones, but similar data were generated using a second set of clones generated using different guide RNA sequences (data not shown).

    Article Snippet: For flow cytometry of ADAM10 on HEK-293T, cells were stained with 10 μg/mL allophycocyanin (APC)-conjugated mouse anti-human ADAM10, or the equivalent negative control mouse IgG (R&D Systems, Abingdon, UK).

    Techniques: Knock-Out, SDS Page, Transformation Assay, Comparison, Double Knockout, Lysis, Western Blot, Expressing, Flow Cytometry, CRISPR, Clone Assay, Generated

    Tspan15/ADAM10 is the most efficient scissor for GPVI in HEK-293T cells. ( Ai ) Tspan15/33 double knockout (T15/33 dKO) HEK-293T cells were transfected with expression constructs for C-terminally Myc-tagged human GPVI and FcRγ (+) or empty vector (–), and FLAG-tagged human Tspan14, Tspan15, Tspan33 or empty vector control (–). Cells were treated with 2 mM NEM (+), or vehicle control (–) for 30 min prior to harvest, and then lysed in 1% Triton X-100 followed by anti-Myc and anti-FLAG Western blotting. ( Aii ) The percentage of cleaved GPVI from Ai was calculated. Error bars represent the standard error of the mean from three independent experiments. Data were arcsine-transformed and statistically analyzed using a two-way ANOVA followed by a Dunnett’s multiple comparison test, compared to their respective non-transfected controls in each stimulation condition (*, p < 0.05, **, p < 0.01; ****, p < 0.0001).

    Journal: International Journal of Molecular Sciences

    Article Title: The Platelet Collagen Receptor GPVI Is Cleaved by Tspan15/ADAM10 and Tspan33/ADAM10 Molecular Scissors

    doi: 10.3390/ijms23052440

    Figure Lengend Snippet: Tspan15/ADAM10 is the most efficient scissor for GPVI in HEK-293T cells. ( Ai ) Tspan15/33 double knockout (T15/33 dKO) HEK-293T cells were transfected with expression constructs for C-terminally Myc-tagged human GPVI and FcRγ (+) or empty vector (–), and FLAG-tagged human Tspan14, Tspan15, Tspan33 or empty vector control (–). Cells were treated with 2 mM NEM (+), or vehicle control (–) for 30 min prior to harvest, and then lysed in 1% Triton X-100 followed by anti-Myc and anti-FLAG Western blotting. ( Aii ) The percentage of cleaved GPVI from Ai was calculated. Error bars represent the standard error of the mean from three independent experiments. Data were arcsine-transformed and statistically analyzed using a two-way ANOVA followed by a Dunnett’s multiple comparison test, compared to their respective non-transfected controls in each stimulation condition (*, p < 0.05, **, p < 0.01; ****, p < 0.0001).

    Article Snippet: For flow cytometry of ADAM10 on HEK-293T, cells were stained with 10 μg/mL allophycocyanin (APC)-conjugated mouse anti-human ADAM10, or the equivalent negative control mouse IgG (R&D Systems, Abingdon, UK).

    Techniques: Double Knockout, Transfection, Expressing, Construct, Plasmid Preparation, Control, Western Blot, Transformation Assay, Comparison

    The extracellular region of Tspan15 is required for efficient GPVI cleavage and the C-terminus is inhibitory. ( A ) Schematic of N-terminally FLAG-tagged Tspan14 (grey) and Tspan15 (black) chimeras, where the entire extracellular region (EC), cytoplasmic domain (Cyto) or C-terminal tail (C) were exchanged. Truncation of both the N- and C-terminal tails is indicated by ΔNC. Ovals represent N-glycosylation sites. ( B ) Wild-type (WT) HEK-293T cells were transfected with expression constructs for C-terminally Myc-tagged GPVI and FcRγ (+) or empty vector (–). In addition to GPVI and FcRγ, Tspan14/15/33 triple knockout (T14/15/33 tKO) HEK-293T cells were co-transfected with HA-tagged ADAM10 alone, or in combination with FLAG-tagged Tspan14 and Tspan15 constructs described in panel A. Cells were lysed in 1% Triton X-100 followed by Western blotting with anti-Myc, anti-FLAG and anti-HA antibodies (top panels). The percentage of cleaved GPVI was calculated (lower panel). Error bars represent the standard error of the mean from three independent experiments. Data were arcsine-transformed and statistically analyzed using a one-way ANOVA followed by a Dunnett’s multiple comparison test, compared to T14/15/33 tKO cells transfected with wild-type Tspan15 and ADAM10 (***, p < 0.001; ****, p < 0.0001).

    Journal: International Journal of Molecular Sciences

    Article Title: The Platelet Collagen Receptor GPVI Is Cleaved by Tspan15/ADAM10 and Tspan33/ADAM10 Molecular Scissors

    doi: 10.3390/ijms23052440

    Figure Lengend Snippet: The extracellular region of Tspan15 is required for efficient GPVI cleavage and the C-terminus is inhibitory. ( A ) Schematic of N-terminally FLAG-tagged Tspan14 (grey) and Tspan15 (black) chimeras, where the entire extracellular region (EC), cytoplasmic domain (Cyto) or C-terminal tail (C) were exchanged. Truncation of both the N- and C-terminal tails is indicated by ΔNC. Ovals represent N-glycosylation sites. ( B ) Wild-type (WT) HEK-293T cells were transfected with expression constructs for C-terminally Myc-tagged GPVI and FcRγ (+) or empty vector (–). In addition to GPVI and FcRγ, Tspan14/15/33 triple knockout (T14/15/33 tKO) HEK-293T cells were co-transfected with HA-tagged ADAM10 alone, or in combination with FLAG-tagged Tspan14 and Tspan15 constructs described in panel A. Cells were lysed in 1% Triton X-100 followed by Western blotting with anti-Myc, anti-FLAG and anti-HA antibodies (top panels). The percentage of cleaved GPVI was calculated (lower panel). Error bars represent the standard error of the mean from three independent experiments. Data were arcsine-transformed and statistically analyzed using a one-way ANOVA followed by a Dunnett’s multiple comparison test, compared to T14/15/33 tKO cells transfected with wild-type Tspan15 and ADAM10 (***, p < 0.001; ****, p < 0.0001).

    Article Snippet: For flow cytometry of ADAM10 on HEK-293T, cells were stained with 10 μg/mL allophycocyanin (APC)-conjugated mouse anti-human ADAM10, or the equivalent negative control mouse IgG (R&D Systems, Abingdon, UK).

    Techniques: Glycoproteomics, Transfection, Expressing, Construct, Plasmid Preparation, Triple Knockout, Western Blot, Transformation Assay, Comparison

    The capacity of Tspan15 wild-type and mutant forms to promote GPVI cleavage is unrelated to the extent to which they co-localise with GPVI. Tspan14/15/33 triple knockout HEK-293T cells were transfected with expression constructs for C-terminally Myc-tagged GPVI, FcRγ, ADAM10 and FLAG-tagged Tspan14 or 15 chimeras that are described in detail in A. Cells were fixed and stained with anti-Myc (GPVI–Myc, magenta) and anti-FLAG (FLAG-Tspan, green) antibodies. ( Ai ) The middle planes of the cells were imaged using Airyscan confocal microscopy in super-resolution mode (scale bar 5 μm). No signal was detected in either channel in the empty vector-transfected cells (data not shown). ( Aii ) The degree of co-localization between GPVI–Myc and FLAG-TspanC8s is presented as the percentage of co-localizing pixels in the GPVI–Myc (magenta) channel. Data are representative of 15 fields of view from three independent experiments and are normalized by arcsine transformation before being statistically analyzed by a one-way ANOVA, followed by Dunnett’s multiple comparison tests, compared to cells transfected with wild-type Tspan15 (**, p < 0.01; ****, p < 0.0001). ( B ) Scatter plot summarising the relationship between degree of co-localization, expressed as the average of data presented in panel Aii , and percentage of GPVI cleaved, expressed as mean of the quantitation presented in B.

    Journal: International Journal of Molecular Sciences

    Article Title: The Platelet Collagen Receptor GPVI Is Cleaved by Tspan15/ADAM10 and Tspan33/ADAM10 Molecular Scissors

    doi: 10.3390/ijms23052440

    Figure Lengend Snippet: The capacity of Tspan15 wild-type and mutant forms to promote GPVI cleavage is unrelated to the extent to which they co-localise with GPVI. Tspan14/15/33 triple knockout HEK-293T cells were transfected with expression constructs for C-terminally Myc-tagged GPVI, FcRγ, ADAM10 and FLAG-tagged Tspan14 or 15 chimeras that are described in detail in A. Cells were fixed and stained with anti-Myc (GPVI–Myc, magenta) and anti-FLAG (FLAG-Tspan, green) antibodies. ( Ai ) The middle planes of the cells were imaged using Airyscan confocal microscopy in super-resolution mode (scale bar 5 μm). No signal was detected in either channel in the empty vector-transfected cells (data not shown). ( Aii ) The degree of co-localization between GPVI–Myc and FLAG-TspanC8s is presented as the percentage of co-localizing pixels in the GPVI–Myc (magenta) channel. Data are representative of 15 fields of view from three independent experiments and are normalized by arcsine transformation before being statistically analyzed by a one-way ANOVA, followed by Dunnett’s multiple comparison tests, compared to cells transfected with wild-type Tspan15 (**, p < 0.01; ****, p < 0.0001). ( B ) Scatter plot summarising the relationship between degree of co-localization, expressed as the average of data presented in panel Aii , and percentage of GPVI cleaved, expressed as mean of the quantitation presented in B.

    Article Snippet: For flow cytometry of ADAM10 on HEK-293T, cells were stained with 10 μg/mL allophycocyanin (APC)-conjugated mouse anti-human ADAM10, or the equivalent negative control mouse IgG (R&D Systems, Abingdon, UK).

    Techniques: Mutagenesis, Triple Knockout, Transfection, Expressing, Construct, Staining, Confocal Microscopy, Plasmid Preparation, Transformation Assay, Comparison, Quantitation Assay

    Co-localization between ADAM10 and GPVI is similar in Tspan14-knockout and Tspan15/33 double knockout HEL cells. Wild-type (WT), Tspan14-knockout (T14 KO) and Tspan15/33 double knockout (T15/33 dKO) HEL cells were treated with 6.2 ng/mL PMA for 72 h. Cells were fixed and stained with anti-ADAM10 mAb (11G2, magenta) and an antibody against the extracellular region of GPVI (336A9, green). Images of the ( A ) basal membrane and ( B ) middle section of the cells were captured using Airyscan confocal microscopy in super-resolution mode (top panels; scale bar 5 μm). No ADAM10 signal was detected in control ADAM10-knockout cells and no GPVI signal was detected in control GPVI-knockout cells (data not shown). The degree of co-localization between ADAM10 and GPVI is presented as the percentage of co-localizing pixels in the ADAM10 (magenta) channel (lower panels). Data are representative of 15 fields of view from three independent experiments and are normalized by arcsine transformation and statistically analyzed by a one-way ANOVA, followed by Bonferroni’s multiple comparison tests (n.s., not significant; *, p < 0.05).

    Journal: International Journal of Molecular Sciences

    Article Title: The Platelet Collagen Receptor GPVI Is Cleaved by Tspan15/ADAM10 and Tspan33/ADAM10 Molecular Scissors

    doi: 10.3390/ijms23052440

    Figure Lengend Snippet: Co-localization between ADAM10 and GPVI is similar in Tspan14-knockout and Tspan15/33 double knockout HEL cells. Wild-type (WT), Tspan14-knockout (T14 KO) and Tspan15/33 double knockout (T15/33 dKO) HEL cells were treated with 6.2 ng/mL PMA for 72 h. Cells were fixed and stained with anti-ADAM10 mAb (11G2, magenta) and an antibody against the extracellular region of GPVI (336A9, green). Images of the ( A ) basal membrane and ( B ) middle section of the cells were captured using Airyscan confocal microscopy in super-resolution mode (top panels; scale bar 5 μm). No ADAM10 signal was detected in control ADAM10-knockout cells and no GPVI signal was detected in control GPVI-knockout cells (data not shown). The degree of co-localization between ADAM10 and GPVI is presented as the percentage of co-localizing pixels in the ADAM10 (magenta) channel (lower panels). Data are representative of 15 fields of view from three independent experiments and are normalized by arcsine transformation and statistically analyzed by a one-way ANOVA, followed by Bonferroni’s multiple comparison tests (n.s., not significant; *, p < 0.05).

    Article Snippet: For flow cytometry of ADAM10 on HEK-293T, cells were stained with 10 μg/mL allophycocyanin (APC)-conjugated mouse anti-human ADAM10, or the equivalent negative control mouse IgG (R&D Systems, Abingdon, UK).

    Techniques: Knock-Out, Double Knockout, Staining, Membrane, Confocal Microscopy, Control, Transformation Assay, Comparison

    Evidence that cut site position on GPVI contributes to specific cleavage by Tspan15/ADAM10 and Tspan33/ADAM10. ( A ) Amino acid alignment of wild-type GPVI and the stalk extension mutants, GPVI+5 and GPVI+10: ADAM10 cut site is denoted by ^; residues inserted are highlighted in grey; transmembrane region is underlined. ( B ) Wild-type (WT) HEK-293T cells were transfected with expression constructs for C-terminally Myc-tagged GPVI and FcRγ (+) or empty vector (–). ADAM10/17 double knockout (A10/17 dKO) HEK-293T cells were co-transfected with GPVI and FcRγ, HA-tagged ADAM10 alone, or in combination with FLAG-tagged TspanC8s (Tspan5, 10, 14, 15, 17 or 33). Cells were lysed in 1% Triton X-100 followed by Western blotting with anti-Myc, anti-FLAG and anti-HA antibodies (data not shown). The percentage of cleaved GPVI was calculated. Cleavage assays for ( C ) GPVI+5 and ( D ) GPVI+10 was performed as described in panel B. Error bars represent the standard error of the mean from three independent experiments. Data were arcsine-transformed and statistically analyzed using a one-way ANOVA followed by a Dunnett’s multiple comparison test, compared to A10/17 dKO cells transfected with ADAM10 alone (*, p < 0.05; **, p < 0.01, ***, p < 0.001; ****, p < 0.0001).

    Journal: International Journal of Molecular Sciences

    Article Title: The Platelet Collagen Receptor GPVI Is Cleaved by Tspan15/ADAM10 and Tspan33/ADAM10 Molecular Scissors

    doi: 10.3390/ijms23052440

    Figure Lengend Snippet: Evidence that cut site position on GPVI contributes to specific cleavage by Tspan15/ADAM10 and Tspan33/ADAM10. ( A ) Amino acid alignment of wild-type GPVI and the stalk extension mutants, GPVI+5 and GPVI+10: ADAM10 cut site is denoted by ^; residues inserted are highlighted in grey; transmembrane region is underlined. ( B ) Wild-type (WT) HEK-293T cells were transfected with expression constructs for C-terminally Myc-tagged GPVI and FcRγ (+) or empty vector (–). ADAM10/17 double knockout (A10/17 dKO) HEK-293T cells were co-transfected with GPVI and FcRγ, HA-tagged ADAM10 alone, or in combination with FLAG-tagged TspanC8s (Tspan5, 10, 14, 15, 17 or 33). Cells were lysed in 1% Triton X-100 followed by Western blotting with anti-Myc, anti-FLAG and anti-HA antibodies (data not shown). The percentage of cleaved GPVI was calculated. Cleavage assays for ( C ) GPVI+5 and ( D ) GPVI+10 was performed as described in panel B. Error bars represent the standard error of the mean from three independent experiments. Data were arcsine-transformed and statistically analyzed using a one-way ANOVA followed by a Dunnett’s multiple comparison test, compared to A10/17 dKO cells transfected with ADAM10 alone (*, p < 0.05; **, p < 0.01, ***, p < 0.001; ****, p < 0.0001).

    Article Snippet: For flow cytometry of ADAM10 on HEK-293T, cells were stained with 10 μg/mL allophycocyanin (APC)-conjugated mouse anti-human ADAM10, or the equivalent negative control mouse IgG (R&D Systems, Abingdon, UK).

    Techniques: Transfection, Expressing, Construct, Plasmid Preparation, Double Knockout, Western Blot, Transformation Assay, Comparison